Mutagenetix > Incidental Mutations

Incidental Mutation 'R5254:Il21'

399309

Institutional Source

Beutler Lab

Gene Symbol

Il21

Ensembl Gene

ENSMUSG00000027718

Gene Name

interleukin 21

Synonyms

MMRRC Submission

042825-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5254 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37222759-37232636 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37227735 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 87 (T87A)

Ref Sequence

ENSEMBL: ENSMUSP00000124668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]

AlphaFold

Q9ES17

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029273
AA Change: T87A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: T87A

Domain	Start	End	E-Value	Type
Pfam:IL15	4	142	7.2e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147691

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161015
AA Change: T87A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: T87A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	26	38	N/A	INTRINSIC
PDB:3TGX\|P	39	140	8e-36	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196943

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	G	T	8: 71,458,398	C296*	probably null	Het
Adam11	T	A	11: 102,774,272	Y413*	probably null	Het
Ankhd1	A	G	18: 36,656,715	I907V	probably benign	Het
Arrdc5	A	G	17: 56,297,897	I130T	probably benign	Het
Asic5	T	A	3: 82,020,987	I419K	probably damaging	Het
Atp4a	A	T	7: 30,715,530	E248V	probably damaging	Het
Avil	C	A	10: 127,011,761	V154L	probably benign	Het
Bclaf1	T	A	10: 20,323,536	H226Q	possibly damaging	Het
Cald1	A	G	6: 34,746,416		probably benign	Het
Cd200r4	A	C	16: 44,832,090	D27A	possibly damaging	Het
Cdsn	T	A	17: 35,552,202	M1K	probably null	Het
Cfap46	T	A	7: 139,678,514	H281L	possibly damaging	Het
Chaf1a	T	C	17: 56,062,606	F533L	probably benign	Het
Chil4	T	A	3: 106,219,452	I5F	probably benign	Het
Ctu2	A	T	8: 122,476,588	R48W	probably damaging	Het
Daam1	A	T	12: 71,946,576	H373L	unknown	Het
Dcaf10	T	A	4: 45,370,415	Y328N	possibly damaging	Het
Dst	A	T	1: 34,177,931	K1151*	probably null	Het
Ect2	T	C	3: 27,130,070	D503G	probably damaging	Het
Epm2a	C	A	10: 11,457,345	D307E	probably benign	Het
Exph5	A	T	9: 53,337,930	D73V	probably damaging	Het
Fam20b	C	T	1: 156,705,740	G102D	probably damaging	Het
Fat2	T	C	11: 55,281,175	N2904S	probably damaging	Het
Flt3	T	A	5: 147,375,690	Q147L	possibly damaging	Het
Fndc11	A	G	2: 181,222,163	T254A	possibly damaging	Het
Galnt15	C	T	14: 32,058,287	R514*	probably null	Het
Gbgt1	A	G	2: 28,505,208	D286G	probably damaging	Het
Ggt1	T	A	10: 75,579,198		probably null	Het
Gm26526	A	T	7: 39,589,234		noncoding transcript	Het
H2-K1	T	C	17: 33,997,462	T237A	probably damaging	Het
Igf1r	T	A	7: 68,207,319	S1010T	probably damaging	Het
Kmt2b	G	A	7: 30,569,175	R2010C	probably damaging	Het
Kmt2c	G	A	5: 25,314,594	P2173S	probably benign	Het
Krt1	A	T	15: 101,846,368	S512T	unknown	Het
Krtap16-1	G	A	11: 99,985,598	R327*	probably null	Het
Lama1	T	A	17: 67,756,716	I745N	probably benign	Het
Lrrk1	T	A	7: 66,307,107	N372I	probably benign	Het
Lyst	A	T	13: 13,683,070	E2481D	probably benign	Het
Map2k1	A	T	9: 64,187,745		probably benign	Het
Mbip	A	G	12: 56,337,443	V215A	probably damaging	Het
Mdc1	T	A	17: 35,847,922	V398D	probably benign	Het
Mog	T	G	17: 37,012,372	I225L	probably benign	Het
Mrgprx3-ps	T	A	7: 47,309,436		noncoding transcript	Het
Muc5b	C	T	7: 141,864,540	S3741L	probably benign	Het
Myo5a	A	T	9: 75,130,120	I202F	probably damaging	Het
Myo5b	A	T	18: 74,700,606	I818F	possibly damaging	Het
Nfia	T	A	4: 98,014,297	M262K	probably damaging	Het
Nisch	C	T	14: 31,206,567		probably null	Het
Nkd1	A	G	8: 88,589,194	D64G	probably damaging	Het
Nt5c2	T	A	19: 46,893,560	K284*	probably null	Het
Olfr1052	A	T	2: 86,297,921	Y35F	probably damaging	Het
Olfr1058	A	T	2: 86,386,140	S93T	possibly damaging	Het
Olfr262	A	G	19: 12,241,248	S138P	probably damaging	Het
Olfr305	A	T	7: 86,364,190	V49E	possibly damaging	Het
Olfr619	T	G	7: 103,603,789	I45R	probably benign	Het
Olfr723	A	T	14: 49,928,779	I255N	probably damaging	Het
Olfr725	C	A	14: 50,034,678	A242S	possibly damaging	Het
Olfr972	A	T	9: 39,873,445	T57S	possibly damaging	Het
Pcdhb17	A	T	18: 37,486,825	D556V	probably damaging	Het
Pcdhga8	A	T	18: 37,726,620	D243V	probably benign	Het
Polq	A	T	16: 37,089,319	Q2355L	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc5a4a	C	A	10: 76,182,738	Y506*	probably null	Het
Sp110	G	C	1: 85,577,202		probably benign	Het
Tarbp1	G	A	8: 126,467,156	H336Y	probably damaging	Het
Tas2r134	T	G	2: 51,627,547	F13V	probably benign	Het
Tgfb2	A	G	1: 186,704,483	Y98H	probably damaging	Het
Tmprss11a	C	A	5: 86,411,806	V376L	probably damaging	Het
Tmprss11f	T	A	5: 86,538,033	K158N	probably benign	Het
Tnip2	G	T	5: 34,503,578	Q177K	probably damaging	Het
Trp53inp1	T	A	4: 11,165,075		probably null	Het
Ttc28	C	T	5: 111,271,238	P1398S	probably benign	Het
Umodl1	T	G	17: 30,980,359	I308S	possibly damaging	Het
Vcan	A	T	13: 89,691,600	S1942T	probably damaging	Het
Vmn2r124	T	A	17: 18,063,077	N344K	probably benign	Het
Vmn2r25	C	G	6: 123,825,318	C542S	probably damaging	Het
Wiz	T	A	17: 32,378,496		probably benign	Het
Wrap73	A	G	4: 154,155,346	Y343C	probably benign	Het

Other mutations in Il21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0433:Il21	UTSW	3	37232535	missense	possibly damaging	0.46
R0579:Il21	UTSW	3	37227774	missense	possibly damaging	0.65
R1641:Il21	UTSW	3	37232532	missense	probably benign	0.00
R1741:Il21	UTSW	3	37227662	missense	probably benign	0.00
R1754:Il21	UTSW	3	37225525	missense	possibly damaging	0.93
R1933:Il21	UTSW	3	37232486	missense	probably benign
R4560:Il21	UTSW	3	37225484	nonsense	probably null
R4975:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R4977:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R4979:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R5267:Il21	UTSW	3	37227797	missense	probably benign
R5641:Il21	UTSW	3	37227768	nonsense	probably null
R7058:Il21	UTSW	3	37232480	missense	probably damaging	1.00
R7259:Il21	UTSW	3	37227654	critical splice donor site	probably null
R9039:Il21	UTSW	3	37232453	missense	probably benign
R9249:Il21	UTSW	3	37225528	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAACTCTGCAAGAAGGTGGG -3'
(R):5'- GGCTGGAATGTCATTTTCAACC -3'

Sequencing Primer
(F):5'- GCATAGTATGTTACAACTAACGGG -3'
(R):5'- CTGGAATGTCATTTTCAACCTTTGG -3'

Posted On

2016-07-06