Incidental Mutation 'R5176:Nr1h4'
ID399310
Institutional Source Beutler Lab
Gene Symbol Nr1h4
Ensembl Gene ENSMUSG00000047638
Gene Namenuclear receptor subfamily 1, group H, member 4
SynonymsRxrip14, FXR, HRR1, Fxr, RIP14
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89454234-89533585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89498255 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 91 (Y91F)
Ref Sequence ENSEMBL: ENSMUSP00000100933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]
Predicted Effect probably benign
Transcript: ENSMUST00000058126
AA Change: Y91F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: Y91F

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 235 285 4e-19 BLAST
HOLI 301 456 9.43e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105296
AA Change: Y91F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: Y91F

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 239 289 4e-19 BLAST
HOLI 305 460 9.43e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105297
AA Change: Y77F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: Y77F

DomainStartEndE-ValueType
ZnF_C4 121 192 1.93e-37 SMART
Blast:HOLI 225 275 3e-19 BLAST
HOLI 291 446 9.43e-32 SMART
Meta Mutation Damage Score 0.0988 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Nr1h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Nr1h4 APN 10 89478807 missense probably benign 0.42
IGL02628:Nr1h4 APN 10 89473839 missense probably damaging 1.00
Aeronaut UTSW 10 89498229 nonsense probably null
I1329:Nr1h4 UTSW 10 89483362 splice site probably benign
IGL02837:Nr1h4 UTSW 10 89516480 missense probably benign 0.00
R0590:Nr1h4 UTSW 10 89456567 missense probably damaging 0.99
R0645:Nr1h4 UTSW 10 89506528 missense probably benign 0.08
R1887:Nr1h4 UTSW 10 89454867 missense possibly damaging 0.64
R1905:Nr1h4 UTSW 10 89480559 missense possibly damaging 0.85
R2471:Nr1h4 UTSW 10 89473894 missense probably damaging 1.00
R2921:Nr1h4 UTSW 10 89498361 missense probably damaging 1.00
R3177:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R3277:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R4656:Nr1h4 UTSW 10 89498253 missense probably benign 0.00
R4676:Nr1h4 UTSW 10 89473874 missense probably damaging 1.00
R4901:Nr1h4 UTSW 10 89478797 missense possibly damaging 0.68
R4993:Nr1h4 UTSW 10 89498180 missense probably benign 0.01
R5117:Nr1h4 UTSW 10 89478422 missense probably damaging 1.00
R5131:Nr1h4 UTSW 10 89483455 missense probably damaging 0.99
R5241:Nr1h4 UTSW 10 89483489 missense probably damaging 1.00
R5580:Nr1h4 UTSW 10 89516440 missense probably benign 0.16
R6114:Nr1h4 UTSW 10 89478816 missense possibly damaging 0.61
R6814:Nr1h4 UTSW 10 89454745 missense probably damaging 0.98
R6888:Nr1h4 UTSW 10 89456542 missense probably damaging 1.00
R6990:Nr1h4 UTSW 10 89454930 missense probably benign 0.18
R7141:Nr1h4 UTSW 10 89498229 nonsense probably null
R7427:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7428:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7560:Nr1h4 UTSW 10 89498261 missense probably benign
X0023:Nr1h4 UTSW 10 89454844 missense possibly damaging 0.45
Z1176:Nr1h4 UTSW 10 89498350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTTGTAGTGGTACCCAGAG -3'
(R):5'- TGCTCTACTTTCTAGAAGGATGAC -3'

Sequencing Primer
(F):5'- TAGTGGTACCCAGAGGCCCTG -3'
(R):5'- CTAGAAGGATGACATTAATTCTGGC -3'
Posted On2016-07-06