Mutagenetix > Incidental Mutations

Incidental Mutation 'R5176:Nr1h4'

399310

Institutional Source

Beutler Lab

Gene Symbol

Nr1h4

Ensembl Gene

ENSMUSG00000047638

Gene Name

nuclear receptor subfamily 1, group H, member 4

Synonyms

Rxrip14, FXR, HRR1, Fxr, RIP14

MMRRC Submission

042756-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.801) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89454234-89533585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89498255 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 91 (Y91F)

Ref Sequence

ENSEMBL: ENSMUSP00000100933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]

Predicted Effect

probably benign
Transcript: ENSMUST00000058126
AA Change: Y91F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: Y91F

Domain	Start	End	E-Value	Type
ZnF_C4	135	206	1.93e-37	SMART
Blast:HOLI	235	285	4e-19	BLAST
HOLI	301	456	9.43e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105296
AA Change: Y91F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: Y91F

Domain	Start	End	E-Value	Type
ZnF_C4	135	206	1.93e-37	SMART
Blast:HOLI	239	289	4e-19	BLAST
HOLI	305	460	9.43e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105297
AA Change: Y77F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: Y77F

Domain	Start	End	E-Value	Type
ZnF_C4	121	192	1.93e-37	SMART
Blast:HOLI	225	275	3e-19	BLAST
HOLI	291	446	9.43e-32	SMART

Meta Mutation Damage Score

0.0988

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Nr1h4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01701:Nr1h4	APN	10	89478807	missense	probably benign	0.42
IGL02628:Nr1h4	APN	10	89473839	missense	probably damaging	1.00
Aeronaut	UTSW	10	89498229	nonsense	probably null
I1329:Nr1h4	UTSW	10	89483362	splice site	probably benign
IGL02837:Nr1h4	UTSW	10	89516480	missense	probably benign	0.00
R0590:Nr1h4	UTSW	10	89456567	missense	probably damaging	0.99
R0645:Nr1h4	UTSW	10	89506528	missense	probably benign	0.08
R1887:Nr1h4	UTSW	10	89454867	missense	possibly damaging	0.64
R1905:Nr1h4	UTSW	10	89480559	missense	possibly damaging	0.85
R2471:Nr1h4	UTSW	10	89473894	missense	probably damaging	1.00
R2921:Nr1h4	UTSW	10	89498361	missense	probably damaging	1.00
R3177:Nr1h4	UTSW	10	89478788	missense	possibly damaging	0.89
R3277:Nr1h4	UTSW	10	89478788	missense	possibly damaging	0.89
R4656:Nr1h4	UTSW	10	89498253	missense	probably benign	0.00
R4676:Nr1h4	UTSW	10	89473874	missense	probably damaging	1.00
R4901:Nr1h4	UTSW	10	89478797	missense	possibly damaging	0.68
R4993:Nr1h4	UTSW	10	89498180	missense	probably benign	0.01
R5117:Nr1h4	UTSW	10	89478422	missense	probably damaging	1.00
R5131:Nr1h4	UTSW	10	89483455	missense	probably damaging	0.99
R5241:Nr1h4	UTSW	10	89483489	missense	probably damaging	1.00
R5580:Nr1h4	UTSW	10	89516440	missense	probably benign	0.16
R6114:Nr1h4	UTSW	10	89478816	missense	possibly damaging	0.61
R6814:Nr1h4	UTSW	10	89454745	missense	probably damaging	0.98
R6888:Nr1h4	UTSW	10	89456542	missense	probably damaging	1.00
R6990:Nr1h4	UTSW	10	89454930	missense	probably benign	0.18
R7141:Nr1h4	UTSW	10	89498229	nonsense	probably null
R7427:Nr1h4	UTSW	10	89498405	missense	probably benign	0.00
R7428:Nr1h4	UTSW	10	89498405	missense	probably benign	0.00
R7560:Nr1h4	UTSW	10	89498261	missense	probably benign
R7986:Nr1h4	UTSW	10	89454772	missense	possibly damaging	0.46
R8881:Nr1h4	UTSW	10	89483489	missense	probably damaging	1.00
X0023:Nr1h4	UTSW	10	89454844	missense	possibly damaging	0.45
Z1176:Nr1h4	UTSW	10	89498350	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGTTGTAGTGGTACCCAGAG -3'
(R):5'- TGCTCTACTTTCTAGAAGGATGAC -3'

Sequencing Primer
(F):5'- TAGTGGTACCCAGAGGCCCTG -3'
(R):5'- CTAGAAGGATGACATTAATTCTGGC -3'

Posted On

2016-07-06