Incidental Mutation 'R5176:Cpsf6'
ID399312
Institutional Source Beutler Lab
Gene Symbol Cpsf6
Ensembl Gene ENSMUSG00000055531
Gene Namecleavage and polyadenylation specific factor 6
SynonymsHPBRII-4, CFIM68, 4733401N12Rik, HPBRII-7
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117344673-117380015 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 117361284 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069168] [ENSMUST00000175924] [ENSMUST00000176480] [ENSMUST00000176670] [ENSMUST00000176686] [ENSMUST00000177145]
Predicted Effect unknown
Transcript: ENSMUST00000069168
AA Change: Q257H
SMART Domains Protein: ENSMUSP00000068408
Gene: ENSMUSG00000055531
AA Change: Q257H

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175924
SMART Domains Protein: ENSMUSP00000135848
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
PDB:3Q2T|D 19 91 3e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176480
SMART Domains Protein: ENSMUSP00000135550
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176567
Predicted Effect unknown
Transcript: ENSMUST00000176670
AA Change: Q294H
SMART Domains Protein: ENSMUSP00000135150
Gene: ENSMUSG00000055531
AA Change: Q294H

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 232 N/A INTRINSIC
low complexity region 273 402 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 459 475 N/A INTRINSIC
low complexity region 526 588 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176686
AA Change: Q257H
SMART Domains Protein: ENSMUSP00000134823
Gene: ENSMUSG00000055531
AA Change: Q257H

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 552 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177145
AA Change: Q257H
SMART Domains Protein: ENSMUSP00000135136
Gene: ENSMUSG00000055531
AA Change: Q257H

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. The cleavage factor complex is composed of four polypeptides. This gene encodes the 68kD subunit. It has a domain organization reminiscent of spliceosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Cpsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cpsf6 APN 10 117366129 unclassified probably benign
IGL03018:Cpsf6 APN 10 117367956 missense probably benign 0.02
IGL03392:Cpsf6 APN 10 117367979 missense probably damaging 1.00
R1006:Cpsf6 UTSW 10 117366068 splice site probably benign
R1239:Cpsf6 UTSW 10 117361343 unclassified probably benign
R1611:Cpsf6 UTSW 10 117361828 intron probably benign
R2041:Cpsf6 UTSW 10 117359128 missense probably damaging 0.99
R2117:Cpsf6 UTSW 10 117366120 unclassified probably benign
R2225:Cpsf6 UTSW 10 117363036 unclassified probably benign
R4752:Cpsf6 UTSW 10 117361368 splice site probably benign
R5001:Cpsf6 UTSW 10 117367961 missense possibly damaging 0.71
R5393:Cpsf6 UTSW 10 117362016 unclassified probably benign
R5696:Cpsf6 UTSW 10 117361029 unclassified probably benign
R7216:Cpsf6 UTSW 10 117362023 missense unknown
R7226:Cpsf6 UTSW 10 117361822 missense unknown
R7522:Cpsf6 UTSW 10 117367829 missense unknown
Z1088:Cpsf6 UTSW 10 117356041 missense unknown
Predicted Primers PCR Primer
(F):5'- GGATTCACATGTGGAGCTGG -3'
(R):5'- AGAGCGAGTCATGGTTTATAAGTTC -3'

Sequencing Primer
(F):5'- TGGTCCCGGAAGATGTGGAG -3'
(R):5'- CTATTTTATAGCTGGACAAACTC -3'
Posted On2016-07-06