Incidental Mutation 'R5176:Ccdc69'
ID399318
Institutional Source Beutler Lab
Gene Symbol Ccdc69
Ensembl Gene ENSMUSG00000049588
Gene Namecoiled-coil domain containing 69
SynonymsD11Ertd461e, 2210021E03Rik
MMRRC Submission 042756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5176 (G1)
Quality Score221
Status Validated
Chromosome11
Chromosomal Location55049731-55078131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55060470 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 42 (A42T)
Ref Sequence ENSEMBL: ENSMUSP00000104508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055040] [ENSMUST00000108880]
Predicted Effect probably benign
Transcript: ENSMUST00000055040
AA Change: A42T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054840
Gene: ENSMUSG00000049588
AA Change: A42T

DomainStartEndE-ValueType
coiled coil region 112 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108880
AA Change: A42T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104508
Gene: ENSMUSG00000049588
AA Change: A42T

DomainStartEndE-ValueType
coiled coil region 112 142 N/A INTRINSIC
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Ccdc69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Ccdc69 APN 11 55052437 missense possibly damaging 0.85
R0140:Ccdc69 UTSW 11 55050499 missense possibly damaging 0.83
R0433:Ccdc69 UTSW 11 55052890 splice site probably null
R1334:Ccdc69 UTSW 11 55052979 missense probably damaging 0.96
R1749:Ccdc69 UTSW 11 55051153 missense probably null 1.00
R2013:Ccdc69 UTSW 11 55051157 missense probably benign 0.03
R2082:Ccdc69 UTSW 11 55052389 missense probably damaging 1.00
R5191:Ccdc69 UTSW 11 55052893 critical splice donor site probably null
R5768:Ccdc69 UTSW 11 55055030 missense possibly damaging 0.81
R5896:Ccdc69 UTSW 11 55052890 splice site probably null
R7476:Ccdc69 UTSW 11 55051198 missense possibly damaging 0.89
RF005:Ccdc69 UTSW 11 55060523 missense probably damaging 1.00
RF024:Ccdc69 UTSW 11 55060523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCAGGAGATGCTTTCAAAAGG -3'
(R):5'- TCCCATCAGTCATAGAGGAGGTG -3'

Sequencing Primer
(F):5'- TTTCAAAAGGAAAGAAAAATGGGTG -3'
(R):5'- AGGAGCCCCCTTGAGTTTC -3'
Posted On2016-07-06