Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Brip1'

399320

Institutional Source

Beutler Lab

Gene Symbol

Brip1

Ensembl Gene

ENSMUSG00000034329

Gene Name

BRCA1 interacting protein C-terminal helicase 1

Synonyms

8030460J03Rik, 3110009N10Rik, BACH1

MMRRC Submission

042756-MU

Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86058138-86201193 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86077884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 825 (Y825C)

Ref Sequence

ENSEMBL: ENSMUSP00000043108 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044423]

AlphaFold

Q5SXJ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000044423
AA Change: Y825C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: Y825C

Domain	Start	End	E-Value	Type
DEXDc	17	520	1.4e-3	SMART
HELICc	701	854	8.2e-41	SMART

Meta Mutation Damage Score

0.6501

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Brip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Brip1	APN	11	86148401	missense	possibly damaging	0.53
IGL01098:Brip1	APN	11	86108862	missense	possibly damaging	0.71
IGL01503:Brip1	APN	11	86061877	missense	probably benign	0.33
IGL01602:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01605:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01940:Brip1	APN	11	86064966	missense	probably benign	0.00
IGL02019:Brip1	APN	11	86197949	missense	possibly damaging	0.73
IGL02212:Brip1	APN	11	86139015	missense	possibly damaging	0.86
IGL02456:Brip1	APN	11	86065099	missense	possibly damaging	0.71
IGL02727:Brip1	APN	11	86152736	missense	probably benign	0.02
IGL02983:Brip1	APN	11	86139124	missense	probably benign	0.03
IGL03022:Brip1	APN	11	86077950	missense	probably damaging	0.98
IGL03116:Brip1	APN	11	86064909	nonsense	probably null
IGL03143:Brip1	APN	11	86061827	missense	possibly damaging	0.53
blip	UTSW	11	86074298	missense	possibly damaging	0.85
Microwave	UTSW	11	86152706	missense	possibly damaging	0.93
radar	UTSW	11	86152669	nonsense	probably null
P0018:Brip1	UTSW	11	86108868	missense	possibly damaging	0.51
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0446:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R0498:Brip1	UTSW	11	86197919	missense	possibly damaging	0.96
R0599:Brip1	UTSW	11	86152737	missense	probably benign
R0653:Brip1	UTSW	11	86152658	missense	possibly damaging	0.85
R0661:Brip1	UTSW	11	86110363	missense	possibly damaging	0.86
R0671:Brip1	UTSW	11	86152667	missense	possibly damaging	0.93
R0718:Brip1	UTSW	11	86143305	missense	possibly damaging	0.96
R0750:Brip1	UTSW	11	86061499	missense	possibly damaging	0.53
R0834:Brip1	UTSW	11	86192827	missense	probably benign
R1128:Brip1	UTSW	11	86064937	missense	possibly damaging	0.86
R1726:Brip1	UTSW	11	86064914	missense	probably benign	0.17
R1813:Brip1	UTSW	11	86187080	missense	possibly damaging	0.53
R1885:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R1886:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R2093:Brip1	UTSW	11	86139145	missense	possibly damaging	0.53
R2206:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R2207:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R3404:Brip1	UTSW	11	86143263	missense	possibly damaging	0.96
R3421:Brip1	UTSW	11	86152669	nonsense	probably null
R3876:Brip1	UTSW	11	86152790	missense	probably damaging	0.98
R4018:Brip1	UTSW	11	86138851	missense	possibly damaging	0.86
R4092:Brip1	UTSW	11	86148521	missense	possibly damaging	0.92
R4384:Brip1	UTSW	11	86148429	missense	possibly damaging	0.70
R4394:Brip1	UTSW	11	86074298	missense	possibly damaging	0.85
R4518:Brip1	UTSW	11	86077878	missense	possibly damaging	0.92
R4522:Brip1	UTSW	11	86189801	missense	possibly damaging	0.49
R4840:Brip1	UTSW	11	86146183	missense	possibly damaging	0.86
R5025:Brip1	UTSW	11	86064980	missense	probably benign	0.04
R5213:Brip1	UTSW	11	86143321	missense	possibly damaging	0.73
R5470:Brip1	UTSW	11	86148542	missense	possibly damaging	0.71
R5525:Brip1	UTSW	11	86110447	missense	possibly damaging	0.85
R6057:Brip1	UTSW	11	86065039	missense	possibly damaging	0.73
R6819:Brip1	UTSW	11	86110441	missense	possibly damaging	0.51
R6908:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R6920:Brip1	UTSW	11	86148536	nonsense	probably null
R7053:Brip1	UTSW	11	86192965	missense	possibly damaging	0.53
R7235:Brip1	UTSW	11	86138875	missense	possibly damaging	0.53
R7253:Brip1	UTSW	11	86143278	missense	possibly damaging	0.96
R7347:Brip1	UTSW	11	86139103	missense	probably benign	0.34
R7476:Brip1	UTSW	11	86157808	missense	probably benign	0.33
R7580:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R7639:Brip1	UTSW	11	86152822	splice site	probably null
R7771:Brip1	UTSW	11	86062024	missense	probably benign	0.02
R8125:Brip1	UTSW	11	86186991	missense	possibly damaging	0.73
R8236:Brip1	UTSW	11	86139112	missense	probably damaging	0.98
R8509:Brip1	UTSW	11	86197948	nonsense	probably null
R8815:Brip1	UTSW	11	86189772	missense	probably benign	0.17
R8877:Brip1	UTSW	11	86152706	missense	possibly damaging	0.93
R8938:Brip1	UTSW	11	86148401	missense	possibly damaging	0.53
R9038:Brip1	UTSW	11	86189773	missense	probably benign	0.01
R9104:Brip1	UTSW	11	86187071	missense	possibly damaging	0.86
R9466:Brip1	UTSW	11	86157758	missense	possibly damaging	0.71
R9645:Brip1	UTSW	11	86061686	missense	probably benign	0.18
R9703:Brip1	UTSW	11	86062004	missense	possibly damaging	0.53
R9774:Brip1	UTSW	11	86187012	missense	possibly damaging	0.73
X0060:Brip1	UTSW	11	86152619	missense	possibly damaging	0.71
X0062:Brip1	UTSW	11	86143356	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- GGATGTCTCAGTTGGCAAAGTG -3'
(R):5'- AGCTGAAACACTCACACGTG -3'

Sequencing Primer
(F):5'- GTGCTTGCCACAGTTTTCAAC -3'
(R):5'- CGTGCAAAACAAGATACCCTAAATC -3'

Posted On

2016-07-06