Incidental Mutation 'R5176:Brip1'
ID399320
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission 042756-MU
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86077884 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 825 (Y825C)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect probably damaging
Transcript: ENSMUST00000044423
AA Change: Y825C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: Y825C

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Meta Mutation Damage Score 0.6501 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Ttll4 C A 1: 74,679,286 H99N probably damaging Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
R7053:Brip1 UTSW 11 86192965 missense possibly damaging 0.53
R7235:Brip1 UTSW 11 86138875 missense possibly damaging 0.53
R7253:Brip1 UTSW 11 86143278 missense possibly damaging 0.96
R7347:Brip1 UTSW 11 86139103 missense probably benign 0.34
R7476:Brip1 UTSW 11 86157808 missense probably benign 0.33
R7580:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R7771:Brip1 UTSW 11 86062024 missense probably benign 0.02
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGATGTCTCAGTTGGCAAAGTG -3'
(R):5'- AGCTGAAACACTCACACGTG -3'

Sequencing Primer
(F):5'- GTGCTTGCCACAGTTTTCAAC -3'
(R):5'- CGTGCAAAACAAGATACCCTAAATC -3'
Posted On2016-07-06