Mutagenetix > Incidental Mutations

Incidental Mutation 'R5176:Brip1'

399320

Institutional Source

Beutler Lab

Gene Symbol

Brip1

Ensembl Gene

ENSMUSG00000034329

Gene Name

BRCA1 interacting protein C-terminal helicase 1

Synonyms

8030460J03Rik, 3110009N10Rik, BACH1

MMRRC Submission

042756-MU

Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86058138-86201193 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86077884 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 825 (Y825C)

Ref Sequence

ENSEMBL: ENSMUSP00000043108 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044423]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044423
AA Change: Y825C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: Y825C

Domain	Start	End	E-Value	Type
DEXDc	17	520	1.4e-3	SMART
HELICc	701	854	8.2e-41	SMART

Meta Mutation Damage Score

0.6501

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Brip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Brip1	APN	11	86148401	missense	possibly damaging	0.53
IGL01098:Brip1	APN	11	86108862	missense	possibly damaging	0.71
IGL01503:Brip1	APN	11	86061877	missense	probably benign	0.33
IGL01602:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01605:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01940:Brip1	APN	11	86064966	missense	probably benign	0.00
IGL02019:Brip1	APN	11	86197949	missense	possibly damaging	0.73
IGL02212:Brip1	APN	11	86139015	missense	possibly damaging	0.86
IGL02456:Brip1	APN	11	86065099	missense	possibly damaging	0.71
IGL02727:Brip1	APN	11	86152736	missense	probably benign	0.02
IGL02983:Brip1	APN	11	86139124	missense	probably benign	0.03
IGL03022:Brip1	APN	11	86077950	missense	probably damaging	0.98
IGL03116:Brip1	APN	11	86064909	nonsense	probably null
IGL03143:Brip1	APN	11	86061827	missense	possibly damaging	0.53
P0018:Brip1	UTSW	11	86108868	missense	possibly damaging	0.51
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0446:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R0498:Brip1	UTSW	11	86197919	missense	possibly damaging	0.96
R0599:Brip1	UTSW	11	86152737	missense	probably benign
R0653:Brip1	UTSW	11	86152658	missense	possibly damaging	0.85
R0661:Brip1	UTSW	11	86110363	missense	possibly damaging	0.86
R0671:Brip1	UTSW	11	86152667	missense	possibly damaging	0.93
R0718:Brip1	UTSW	11	86143305	missense	possibly damaging	0.96
R0750:Brip1	UTSW	11	86061499	missense	possibly damaging	0.53
R0834:Brip1	UTSW	11	86192827	missense	probably benign
R1128:Brip1	UTSW	11	86064937	missense	possibly damaging	0.86
R1726:Brip1	UTSW	11	86064914	missense	probably benign	0.17
R1813:Brip1	UTSW	11	86187080	missense	possibly damaging	0.53
R1885:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R1886:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R2093:Brip1	UTSW	11	86139145	missense	possibly damaging	0.53
R2206:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R2207:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R3404:Brip1	UTSW	11	86143263	missense	possibly damaging	0.96
R3421:Brip1	UTSW	11	86152669	nonsense	probably null
R3876:Brip1	UTSW	11	86152790	missense	probably damaging	0.98
R4018:Brip1	UTSW	11	86138851	missense	possibly damaging	0.86
R4092:Brip1	UTSW	11	86148521	missense	possibly damaging	0.92
R4384:Brip1	UTSW	11	86148429	missense	possibly damaging	0.70
R4394:Brip1	UTSW	11	86074298	missense	possibly damaging	0.85
R4518:Brip1	UTSW	11	86077878	missense	possibly damaging	0.92
R4522:Brip1	UTSW	11	86189801	missense	possibly damaging	0.49
R4840:Brip1	UTSW	11	86146183	missense	possibly damaging	0.86
R5025:Brip1	UTSW	11	86064980	missense	probably benign	0.04
R5213:Brip1	UTSW	11	86143321	missense	possibly damaging	0.73
R5470:Brip1	UTSW	11	86148542	missense	possibly damaging	0.71
R5525:Brip1	UTSW	11	86110447	missense	possibly damaging	0.85
R6057:Brip1	UTSW	11	86065039	missense	possibly damaging	0.73
R6819:Brip1	UTSW	11	86110441	missense	possibly damaging	0.51
R6908:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R6920:Brip1	UTSW	11	86148536	nonsense	probably null
R7053:Brip1	UTSW	11	86192965	missense	possibly damaging	0.53
R7235:Brip1	UTSW	11	86138875	missense	possibly damaging	0.53
R7253:Brip1	UTSW	11	86143278	missense	possibly damaging	0.96
R7347:Brip1	UTSW	11	86139103	missense	probably benign	0.34
R7476:Brip1	UTSW	11	86157808	missense	probably benign	0.33
R7580:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R7771:Brip1	UTSW	11	86062024	missense	probably benign	0.02
X0060:Brip1	UTSW	11	86152619	missense	possibly damaging	0.71
X0062:Brip1	UTSW	11	86143356	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- GGATGTCTCAGTTGGCAAAGTG -3'
(R):5'- AGCTGAAACACTCACACGTG -3'

Sequencing Primer
(F):5'- GTGCTTGCCACAGTTTTCAAC -3'
(R):5'- CGTGCAAAACAAGATACCCTAAATC -3'

Posted On

2016-07-06