Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Muc19'

399336

Institutional Source

Beutler Lab

Gene Symbol

Muc19

Ensembl Gene

ENSMUSG00000044021

Gene Name

mucin 19

Synonyms

apomucin, sld

MMRRC Submission

042756-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91838326-91934555 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

A to G at 91892180 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160242

SMART Domains

Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	21	34	N/A	INTRINSIC
VWD	47	198	1.31e-13	SMART
Pfam:C8	221	293	1.1e-8	PFAM
Pfam:TIL	298	353	1.6e-11	PFAM
VWD	383	545	1.58e-25	SMART
C8	577	651	8.71e-20	SMART
Pfam:TIL	654	711	2.1e-7	PFAM
Pfam:TIL	753	813	5.2e-8	PFAM
VWD	842	1005	2.36e-47	SMART
C8	1041	1115	1.84e-27	SMART
low complexity region	1220	1254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178108

SMART Domains

Protein: ENSMUSP00000136475
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
VWD	30	181	1.31e-13	SMART
Pfam:C8	200	277	2.5e-8	PFAM
Pfam:TIL	281	336	7.5e-12	PFAM
Pfam:VWD	377	477	4.1e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180042

SMART Domains

Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
C8	17	91	8.71e-20	SMART
Pfam:TIL	94	151	1.2e-7	PFAM
Pfam:TIL	193	253	6.6e-8	PFAM
VWD	282	445	2.36e-47	SMART
C8	481	555	1.84e-27	SMART
low complexity region	660	701	N/A	INTRINSIC

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Ctif	C	T	18: 75,637,219	V32M	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Muc19

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00985:Muc19	APN	15	91886749	exon	noncoding transcript
IGL01017:Muc19	APN	15	91880707	exon	noncoding transcript
IGL01140:Muc19	APN	15	91899399	exon	noncoding transcript
IGL01292:Muc19	APN	15	91894276	exon	noncoding transcript
IGL01397:Muc19	APN	15	91894304	exon	noncoding transcript
IGL01525:Muc19	APN	15	91886683	exon	noncoding transcript
IGL01589:Muc19	APN	15	91870501	exon	noncoding transcript
IGL02023:Muc19	APN	15	91888259	exon	noncoding transcript
IGL02088:Muc19	APN	15	91891168	splice site	noncoding transcript
IGL02168:Muc19	APN	15	91894098	exon	noncoding transcript
IGL02343:Muc19	APN	15	91894234	exon	noncoding transcript
IGL02402:Muc19	APN	15	91893998	splice site	noncoding transcript
IGL02433:Muc19	APN	15	91872496	exon	noncoding transcript
IGL02533:Muc19	APN	15	91898047	exon	noncoding transcript
IGL02558:Muc19	APN	15	91897622	exon	noncoding transcript
IGL02652:Muc19	APN	15	91877815	critical splice donor site	noncoding transcript
IGL03032:Muc19	APN	15	91910539	unclassified	noncoding transcript
IGL02837:Muc19	UTSW	15	91882656	exon	noncoding transcript
R0098:Muc19	UTSW	15	91892907	exon	noncoding transcript
R0098:Muc19	UTSW	15	91892907	exon	noncoding transcript
R0208:Muc19	UTSW	15	91893024	splice site	noncoding transcript
R0597:Muc19	UTSW	15	91900502	splice site	noncoding transcript
R1185:Muc19	UTSW	15	91878549	exon	noncoding transcript
R1185:Muc19	UTSW	15	91878549	exon	noncoding transcript
R1469:Muc19	UTSW	15	91874300	unclassified	noncoding transcript
R1942:Muc19	UTSW	15	91892472	exon	noncoding transcript
R2035:Muc19	UTSW	15	91892405	splice site	noncoding transcript
R2208:Muc19	UTSW	15	91871549	exon	noncoding transcript
R2877:Muc19	UTSW	15	91893006	exon	noncoding transcript
R2897:Muc19	UTSW	15	91924665	critical splice donor site	noncoding transcript
R4110:Muc19	UTSW	15	91897622	exon	noncoding transcript
R4403:Muc19	UTSW	15	91871570	exon	noncoding transcript
R4606:Muc19	UTSW	15	91934383	exon	noncoding transcript
R4677:Muc19	UTSW	15	91888217	exon	noncoding transcript
R4753:Muc19	UTSW	15	91877761	unclassified	noncoding transcript
R4781:Muc19	UTSW	15	91903166	critical splice donor site	noncoding transcript
R4869:Muc19	UTSW	15	91897716	exon	noncoding transcript
R5000:Muc19	UTSW	15	91873231	unclassified	noncoding transcript
R5044:Muc19	UTSW	15	91888138	exon	noncoding transcript
R5156:Muc19	UTSW	15	91900420	exon	noncoding transcript
R5224:Muc19	UTSW	15	91928025	exon	noncoding transcript
R5524:Muc19	UTSW	15	91894393	exon	noncoding transcript
R5568:Muc19	UTSW	15	91884274	splice site	noncoding transcript
R5592:Muc19	UTSW	15	91930314	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- ACGTGCCAGAACTCCTACTTC -3'
(R):5'- TGGGAATCAACACTTCTGTCATCATG -3'

Sequencing Primer
(F):5'- ACTCCTACTTCTTAAATAACGTGGC -3'
(R):5'- CACCATCAGTTTCAAGTTAAGTGC -3'

Posted On

2016-07-06