Mutagenetix > Incidental Mutation

Incidental Mutation 'R5176:Ctif'

399347

Institutional Source

Beutler Lab

Gene Symbol

Ctif

Ensembl Gene

ENSMUSG00000052928

Gene Name

CBP80/20-dependent translation initiation factor

Synonyms

LOC269037, Gm672

MMRRC Submission

042756-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.115) question?

Stock #

R5176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75431224-75697696 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 75637219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 32 (V32M)

Ref Sequence

ENSEMBL: ENSMUSP00000129974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165559]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000165559
AA Change: V32M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129974
Gene: ENSMUSG00000052928
AA Change: V32M

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	188	204	N/A	INTRINSIC
low complexity region	347	360	N/A	INTRINSIC
MIF4G	401	602	5.46e-35	SMART

Meta Mutation Damage Score

0.2255

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]).[supplied by OMIM, Dec 2009]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca7	C	A	10: 79,998,289	H116Q	probably benign	Het
Akap12	G	T	10: 4,353,947	E252D	probably benign	Het
Apobr	A	G	7: 126,585,016	D2G	probably damaging	Het
Arhgef12	A	T	9: 43,020,686	H168Q	probably damaging	Het
Asb3	T	A	11: 31,081,357		probably null	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Cacna1b	A	T	2: 24,635,131	Y1679N	probably damaging	Het
Ccdc69	C	T	11: 55,060,470	A42T	probably benign	Het
Cds1	G	T	5: 101,781,420	D55Y	possibly damaging	Het
Cep135	C	A	5: 76,637,026	D989E	probably benign	Het
Cpsf6	C	A	10: 117,361,284		probably benign	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dao	T	C	5: 114,020,009		probably null	Het
Dopey1	T	A	9: 86,521,815	N1689K	probably damaging	Het
Dopey2	A	G	16: 93,740,043	Y14C	probably damaging	Het
E130309D02Rik	G	T	5: 143,315,075	S7*	probably null	Het
Fam160b1	A	G	19: 57,371,181	N51S	probably damaging	Het
Fam187a	C	T	11: 102,886,464	R365C	probably damaging	Het
Fastkd2	A	G	1: 63,731,439		probably benign	Het
Fkbp15	G	T	4: 62,312,323	L718I	possibly damaging	Het
Gabbr2	C	A	4: 46,681,208	V118F	probably damaging	Het
Gm11492	T	A	11: 87,567,532	M244K	probably benign	Het
Gm13991	T	A	2: 116,528,027		noncoding transcript	Het
H2-M9	T	C	17: 36,641,631	I174M	probably damaging	Het
Insr	T	A	8: 3,158,742	M1240L	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Mad2l1bp	T	A	17: 46,152,812	E95D	probably benign	Het
March9	T	C	10: 127,059,450	D102G	probably benign	Het
Muc19	A	G	15: 91,892,180		noncoding transcript	Het
Nr1h4	T	A	10: 89,498,255	Y91F	probably benign	Het
Nr5a2	A	T	1: 136,948,802	M1K	probably null	Het
Olfr561	T	A	7: 102,775,306	S261T	probably damaging	Het
Olfr836	A	T	9: 19,121,360	Y132F	probably damaging	Het
Olfr998	A	C	2: 85,591,435	K298N	possibly damaging	Het
Oprd1	T	C	4: 132,113,793	T285A	probably benign	Het
Optc	T	C	1: 133,902,084	N196S	probably benign	Het
Panx2	G	T	15: 89,060,228	R52L	probably damaging	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pot1b	T	A	17: 55,699,995	T41S	probably benign	Het
Prss56	T	C	1: 87,184,158	L37S	probably damaging	Het
Ptk2b	T	C	14: 66,156,415	T870A	probably damaging	Het
Rabep2	C	A	7: 126,434,293		probably benign	Het
Rbm48	A	C	5: 3,595,444	V80G	probably damaging	Het
Rhou	G	T	8: 123,654,109	C55F	possibly damaging	Het
Rnaseh2c	A	G	19: 5,602,042	D45G	probably benign	Het
Rusc1	A	G	3: 89,089,082	S109P	probably damaging	Het
Ryr3	T	C	2: 112,757,667	D2643G	possibly damaging	Het
Sik2	T	C	9: 50,899,403	E471G	probably benign	Het
Sipa1	A	G	19: 5,659,378	S310P	probably damaging	Het
Spen	T	C	4: 141,476,276	E1680G	unknown	Het
Steap3	C	T	1: 120,243,767		probably null	Het
Tmeff2	T	A	1: 51,071,541	C171*	probably null	Het
Tmem138	A	T	19: 10,575,270	M33K	probably benign	Het
Trappc11	C	A	8: 47,510,963	V601L	possibly damaging	Het
Ttc30a2	T	C	2: 75,977,077	M364V	probably benign	Het
Ttll4	C	A	1: 74,679,286	H99N	probably damaging	Het
Uchl4	A	T	9: 64,235,740	K168*	probably null	Het
Wdr17	C	T	8: 54,653,878		probably null	Het
Xpo1	A	G	11: 23,295,977	D1029G	probably damaging	Het
Zfp719	G	T	7: 43,591,125	K712N	probably damaging	Het

Other mutations in Ctif

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Ctif	APN	18	75437176	missense	possibly damaging	0.95
IGL01481:Ctif	APN	18	75611784	splice site	probably benign
IGL02299:Ctif	APN	18	75637245	missense	probably damaging	1.00
IGL02319:Ctif	APN	18	75521873	splice site	probably benign
IGL03130:Ctif	APN	18	75521618	missense	probably benign
R0304:Ctif	UTSW	18	75521818	missense	probably benign	0.09
R0730:Ctif	UTSW	18	75565012	missense	probably damaging	0.99
R0835:Ctif	UTSW	18	75435336	missense	probably damaging	1.00
R1226:Ctif	UTSW	18	75521579	small deletion	probably benign
R1302:Ctif	UTSW	18	75521678	missense	probably benign	0.22
R1549:Ctif	UTSW	18	75565025	missense	probably damaging	1.00
R1674:Ctif	UTSW	18	75637180	missense	probably benign	0.00
R1697:Ctif	UTSW	18	75624305	splice site	probably benign
R1848:Ctif	UTSW	18	75519941	missense	probably damaging	0.96
R2102:Ctif	UTSW	18	75521381	missense	probably benign
R3499:Ctif	UTSW	18	75611757	missense	possibly damaging	0.94
R3878:Ctif	UTSW	18	75519977	missense	probably damaging	0.96
R4157:Ctif	UTSW	18	75435270	missense	probably benign	0.42
R4168:Ctif	UTSW	18	75637215	missense	probably damaging	1.00
R4225:Ctif	UTSW	18	75435237	missense	probably benign	0.01
R4560:Ctif	UTSW	18	75519881	missense	probably damaging	1.00
R4822:Ctif	UTSW	18	75521561	missense	probably benign	0.01
R5824:Ctif	UTSW	18	75610678	missense	possibly damaging	0.55
R6824:Ctif	UTSW	18	75521711	missense	probably damaging	1.00
R6934:Ctif	UTSW	18	75435360	missense	probably benign	0.07
R7014:Ctif	UTSW	18	75437208	missense	possibly damaging	0.82
R7115:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R7169:Ctif	UTSW	18	75472016	missense	probably damaging	0.99
R7187:Ctif	UTSW	18	75637219	missense	probably damaging	1.00
R7355:Ctif	UTSW	18	75610685	missense	probably damaging	0.98
R7402:Ctif	UTSW	18	75611736	missense	probably benign	0.18
R7451:Ctif	UTSW	18	75519803	missense	possibly damaging	0.82
R7648:Ctif	UTSW	18	75637142	missense	probably benign	0.04
R7671:Ctif	UTSW	18	75472016	missense	probably damaging	0.99
R7746:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R7765:Ctif	UTSW	18	75605644	missense	probably damaging	1.00
R8151:Ctif	UTSW	18	75520105	missense	probably benign
R8358:Ctif	UTSW	18	75565044	missense	possibly damaging	0.68
R8782:Ctif	UTSW	18	75521797	missense	probably benign	0.35
R8829:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R8963:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R9032:Ctif	UTSW	18	75471803	critical splice donor site	probably benign
R9069:Ctif	UTSW	18	75521387	missense	probably damaging	0.99
R9631:Ctif	UTSW	18	75471954	missense	probably benign	0.03
R9645:Ctif	UTSW	18	75624281	missense	probably benign	0.20
X0027:Ctif	UTSW	18	75637263	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTGTCAGGTGAGATCAC -3'
(R):5'- TCTCAAGTGGGGCATTGTCC -3'

Sequencing Primer
(F):5'- GTGAGATCACCAATACTGAGATCAC -3'
(R):5'- GGCATTGTCCTGGCCTC -3'

Posted On

2016-07-06