Incidental Mutation 'R5254:Or14a259'
ID 399348
Institutional Source Beutler Lab
Gene Symbol Or14a259
Ensembl Gene ENSMUSG00000055571
Gene Name olfactory receptor family 14 subfamily A member 259
Synonyms GA_x6K02T2NHDJ-9744055-9745014, Olfr305, MOR219-2
MMRRC Submission 042825-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R5254 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 86012584-86013543 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86013398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 49 (V49E)
Ref Sequence ENSEMBL: ENSMUSP00000149883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]
AlphaFold Q7TS02
Predicted Effect possibly damaging
Transcript: ENSMUST00000069236
AA Change: V49E

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571
AA Change: V49E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-40 PFAM
Pfam:7tm_1 39 288 3.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213255
AA Change: V49E

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213869
AA Change: V49E

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216700
AA Change: V49E

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,911,042 (GRCm39) C296* probably null Het
Adam11 T A 11: 102,665,098 (GRCm39) Y413* probably null Het
Ankhd1 A G 18: 36,789,768 (GRCm39) I907V probably benign Het
Arrdc5 A G 17: 56,604,897 (GRCm39) I130T probably benign Het
Asic5 T A 3: 81,928,294 (GRCm39) I419K probably damaging Het
Atp4a A T 7: 30,414,955 (GRCm39) E248V probably damaging Het
Avil C A 10: 126,847,630 (GRCm39) V154L probably benign Het
Bclaf1 T A 10: 20,199,282 (GRCm39) H226Q possibly damaging Het
Cald1 A G 6: 34,723,351 (GRCm39) probably benign Het
Cd200r4 A C 16: 44,652,453 (GRCm39) D27A possibly damaging Het
Cdsn T A 17: 35,863,099 (GRCm39) M1K probably null Het
Cfap46 T A 7: 139,258,430 (GRCm39) H281L possibly damaging Het
Chaf1a T C 17: 56,369,606 (GRCm39) F533L probably benign Het
Chil4 T A 3: 106,126,768 (GRCm39) I5F probably benign Het
Ctu2 A T 8: 123,203,327 (GRCm39) R48W probably damaging Het
Daam1 A T 12: 71,993,350 (GRCm39) H373L unknown Het
Dcaf10 T A 4: 45,370,415 (GRCm39) Y328N possibly damaging Het
Dst A T 1: 34,217,012 (GRCm39) K1151* probably null Het
Ect2 T C 3: 27,184,219 (GRCm39) D503G probably damaging Het
Epm2a C A 10: 11,333,089 (GRCm39) D307E probably benign Het
Exph5 A T 9: 53,249,230 (GRCm39) D73V probably damaging Het
Fam20b C T 1: 156,533,310 (GRCm39) G102D probably damaging Het
Fat2 T C 11: 55,172,001 (GRCm39) N2904S probably damaging Het
Flt3 T A 5: 147,312,500 (GRCm39) Q147L possibly damaging Het
Fndc11 A G 2: 180,863,956 (GRCm39) T254A possibly damaging Het
Galnt15 C T 14: 31,780,244 (GRCm39) R514* probably null Het
Gbgt1 A G 2: 28,395,220 (GRCm39) D286G probably damaging Het
Ggt1 T A 10: 75,415,032 (GRCm39) probably null Het
Gm26526 A T 7: 39,238,658 (GRCm39) noncoding transcript Het
H2-K2 T C 17: 34,216,436 (GRCm39) T237A probably damaging Het
Igf1r T A 7: 67,857,067 (GRCm39) S1010T probably damaging Het
Il21 T C 3: 37,281,884 (GRCm39) T87A possibly damaging Het
Kmt2b G A 7: 30,268,600 (GRCm39) R2010C probably damaging Het
Kmt2c G A 5: 25,519,592 (GRCm39) P2173S probably benign Het
Krt1 A T 15: 101,754,803 (GRCm39) S512T unknown Het
Krtap16-1 G A 11: 99,876,424 (GRCm39) R327* probably null Het
Lama1 T A 17: 68,063,711 (GRCm39) I745N probably benign Het
Lrrk1 T A 7: 65,956,855 (GRCm39) N372I probably benign Het
Lyst A T 13: 13,857,655 (GRCm39) E2481D probably benign Het
Map2k1 A T 9: 64,095,027 (GRCm39) probably benign Het
Mbip A G 12: 56,384,228 (GRCm39) V215A probably damaging Het
Mdc1 T A 17: 36,158,814 (GRCm39) V398D probably benign Het
Mog T G 17: 37,323,264 (GRCm39) I225L probably benign Het
Mrgprx3-ps T A 7: 46,959,184 (GRCm39) noncoding transcript Het
Muc5b C T 7: 141,418,277 (GRCm39) S3741L probably benign Het
Myo5a A T 9: 75,037,402 (GRCm39) I202F probably damaging Het
Myo5b A T 18: 74,833,677 (GRCm39) I818F possibly damaging Het
Nfia T A 4: 97,902,534 (GRCm39) M262K probably damaging Het
Nisch C T 14: 30,928,524 (GRCm39) probably null Het
Nkd1 A G 8: 89,315,822 (GRCm39) D64G probably damaging Het
Nt5c2 T A 19: 46,881,999 (GRCm39) K284* probably null Het
Or4k15b C A 14: 50,272,135 (GRCm39) A242S possibly damaging Het
Or4l1 A T 14: 50,166,236 (GRCm39) I255N probably damaging Het
Or52z14 T G 7: 103,252,996 (GRCm39) I45R probably benign Het
Or5an1c A G 19: 12,218,612 (GRCm39) S138P probably damaging Het
Or5j3 A T 2: 86,128,265 (GRCm39) Y35F probably damaging Het
Or8g55 A T 9: 39,784,741 (GRCm39) T57S possibly damaging Het
Or8k24 A T 2: 86,216,484 (GRCm39) S93T possibly damaging Het
Pcdhb17 A T 18: 37,619,878 (GRCm39) D556V probably damaging Het
Pcdhga8 A T 18: 37,859,673 (GRCm39) D243V probably benign Het
Polq A T 16: 36,909,681 (GRCm39) Q2355L probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc5a4a C A 10: 76,018,572 (GRCm39) Y506* probably null Het
Sp110 G C 1: 85,504,923 (GRCm39) probably benign Het
Tarbp1 G A 8: 127,193,895 (GRCm39) H336Y probably damaging Het
Tas2r134 T G 2: 51,517,559 (GRCm39) F13V probably benign Het
Tgfb2 A G 1: 186,436,680 (GRCm39) Y98H probably damaging Het
Tmprss11a C A 5: 86,559,665 (GRCm39) V376L probably damaging Het
Tmprss11f T A 5: 86,685,892 (GRCm39) K158N probably benign Het
Tnip2 G T 5: 34,660,922 (GRCm39) Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 (GRCm39) probably null Het
Ttc28 C T 5: 111,419,104 (GRCm39) P1398S probably benign Het
Umodl1 T G 17: 31,199,333 (GRCm39) I308S possibly damaging Het
Vcan A T 13: 89,839,719 (GRCm39) S1942T probably damaging Het
Vmn2r124 T A 17: 18,283,339 (GRCm39) N344K probably benign Het
Vmn2r25 C G 6: 123,802,277 (GRCm39) C542S probably damaging Het
Wiz T A 17: 32,597,470 (GRCm39) probably benign Het
Wrap73 A G 4: 154,239,803 (GRCm39) Y343C probably benign Het
Other mutations in Or14a259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Or14a259 APN 7 86,012,768 (GRCm39) missense possibly damaging 0.46
IGL02102:Or14a259 APN 7 86,013,074 (GRCm39) missense probably benign 0.25
IGL02424:Or14a259 APN 7 86,012,688 (GRCm39) missense probably benign 0.02
IGL02664:Or14a259 APN 7 86,012,811 (GRCm39) missense possibly damaging 0.94
IGL03167:Or14a259 APN 7 86,013,128 (GRCm39) missense probably damaging 1.00
R0035:Or14a259 UTSW 7 86,013,395 (GRCm39) missense possibly damaging 0.95
R0373:Or14a259 UTSW 7 86,013,013 (GRCm39) nonsense probably null
R0510:Or14a259 UTSW 7 86,013,035 (GRCm39) missense probably benign 0.21
R2214:Or14a259 UTSW 7 86,013,414 (GRCm39) missense probably benign 0.01
R3147:Or14a259 UTSW 7 86,013,092 (GRCm39) missense probably benign 0.01
R3623:Or14a259 UTSW 7 86,013,308 (GRCm39) missense probably benign 0.02
R4155:Or14a259 UTSW 7 86,013,270 (GRCm39) missense probably benign 0.00
R4332:Or14a259 UTSW 7 86,013,080 (GRCm39) missense probably benign 0.01
R4785:Or14a259 UTSW 7 86,012,943 (GRCm39) missense probably damaging 1.00
R4834:Or14a259 UTSW 7 86,012,952 (GRCm39) missense probably benign 0.21
R4871:Or14a259 UTSW 7 86,012,692 (GRCm39) missense probably damaging 1.00
R5161:Or14a259 UTSW 7 86,013,546 (GRCm39) splice site probably null
R6430:Or14a259 UTSW 7 86,013,181 (GRCm39) nonsense probably null
R7734:Or14a259 UTSW 7 86,013,476 (GRCm39) missense not run
R8520:Or14a259 UTSW 7 86,013,471 (GRCm39) missense probably benign 0.00
R8682:Or14a259 UTSW 7 86,013,373 (GRCm39) missense probably damaging 0.99
R9407:Or14a259 UTSW 7 86,013,194 (GRCm39) nonsense probably null
R9728:Or14a259 UTSW 7 86,012,771 (GRCm39) missense probably damaging 1.00
RF010:Or14a259 UTSW 7 86,012,594 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACCTCATAATGTAGGGGACTG -3'
(R):5'- CATCTGACAGGTTGTGTGAATAATC -3'

Sequencing Primer
(F):5'- TACTTCTCCTGATCCAAGGAGAG -3'
(R):5'- ATCTATTATGCCCAATGTCACTGCAG -3'
Posted On 2016-07-06