Incidental Mutation 'R5254:Nkd1'
ID 399358
Institutional Source Beutler Lab
Gene Symbol Nkd1
Ensembl Gene ENSMUSG00000031661
Gene Name naked cuticle 1
Synonyms 2810434J10Rik, 9030215G15Rik
MMRRC Submission 042825-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.584) question?
Stock # R5254 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 89247982-89321512 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89315822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 64 (D64G)
Ref Sequence ENSEMBL: ENSMUSP00000147347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034086] [ENSMUST00000169179] [ENSMUST00000211113]
AlphaFold Q99MH6
Predicted Effect probably damaging
Transcript: ENSMUST00000034086
AA Change: D168G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034086
Gene: ENSMUSG00000031661
AA Change: D168G

DomainStartEndE-ValueType
SCOP:d2pvba_ 121 164 1e-3 SMART
low complexity region 379 397 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169179
AA Change: D64G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125935
Gene: ENSMUSG00000031661
AA Change: D64G

DomainStartEndE-ValueType
SCOP:d2pvba_ 17 60 5e-4 SMART
low complexity region 275 293 N/A INTRINSIC
low complexity region 349 363 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211113
AA Change: D64G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1559 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In the mouse, Nkd is a Dishevelled (see DVL1; MIM 601365)-binding protein that functions as a negative regulator of the Wnt (see WNT1; MIM 164820)-beta-catenin (see MIM 116806)-Tcf (see MIM 602272) signaling pathway.[supplied by OMIM, Jun 2003]
PHENOTYPE: Homozygous null mice display reduced male fertility with oligozoospermia, small testis, and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,911,042 (GRCm39) C296* probably null Het
Adam11 T A 11: 102,665,098 (GRCm39) Y413* probably null Het
Ankhd1 A G 18: 36,789,768 (GRCm39) I907V probably benign Het
Arrdc5 A G 17: 56,604,897 (GRCm39) I130T probably benign Het
Asic5 T A 3: 81,928,294 (GRCm39) I419K probably damaging Het
Atp4a A T 7: 30,414,955 (GRCm39) E248V probably damaging Het
Avil C A 10: 126,847,630 (GRCm39) V154L probably benign Het
Bclaf1 T A 10: 20,199,282 (GRCm39) H226Q possibly damaging Het
Cald1 A G 6: 34,723,351 (GRCm39) probably benign Het
Cd200r4 A C 16: 44,652,453 (GRCm39) D27A possibly damaging Het
Cdsn T A 17: 35,863,099 (GRCm39) M1K probably null Het
Cfap46 T A 7: 139,258,430 (GRCm39) H281L possibly damaging Het
Chaf1a T C 17: 56,369,606 (GRCm39) F533L probably benign Het
Chil4 T A 3: 106,126,768 (GRCm39) I5F probably benign Het
Ctu2 A T 8: 123,203,327 (GRCm39) R48W probably damaging Het
Daam1 A T 12: 71,993,350 (GRCm39) H373L unknown Het
Dcaf10 T A 4: 45,370,415 (GRCm39) Y328N possibly damaging Het
Dst A T 1: 34,217,012 (GRCm39) K1151* probably null Het
Ect2 T C 3: 27,184,219 (GRCm39) D503G probably damaging Het
Epm2a C A 10: 11,333,089 (GRCm39) D307E probably benign Het
Exph5 A T 9: 53,249,230 (GRCm39) D73V probably damaging Het
Fam20b C T 1: 156,533,310 (GRCm39) G102D probably damaging Het
Fat2 T C 11: 55,172,001 (GRCm39) N2904S probably damaging Het
Flt3 T A 5: 147,312,500 (GRCm39) Q147L possibly damaging Het
Fndc11 A G 2: 180,863,956 (GRCm39) T254A possibly damaging Het
Galnt15 C T 14: 31,780,244 (GRCm39) R514* probably null Het
Gbgt1 A G 2: 28,395,220 (GRCm39) D286G probably damaging Het
Ggt1 T A 10: 75,415,032 (GRCm39) probably null Het
Gm26526 A T 7: 39,238,658 (GRCm39) noncoding transcript Het
H2-K2 T C 17: 34,216,436 (GRCm39) T237A probably damaging Het
Igf1r T A 7: 67,857,067 (GRCm39) S1010T probably damaging Het
Il21 T C 3: 37,281,884 (GRCm39) T87A possibly damaging Het
Kmt2b G A 7: 30,268,600 (GRCm39) R2010C probably damaging Het
Kmt2c G A 5: 25,519,592 (GRCm39) P2173S probably benign Het
Krt1 A T 15: 101,754,803 (GRCm39) S512T unknown Het
Krtap16-1 G A 11: 99,876,424 (GRCm39) R327* probably null Het
Lama1 T A 17: 68,063,711 (GRCm39) I745N probably benign Het
Lrrk1 T A 7: 65,956,855 (GRCm39) N372I probably benign Het
Lyst A T 13: 13,857,655 (GRCm39) E2481D probably benign Het
Map2k1 A T 9: 64,095,027 (GRCm39) probably benign Het
Mbip A G 12: 56,384,228 (GRCm39) V215A probably damaging Het
Mdc1 T A 17: 36,158,814 (GRCm39) V398D probably benign Het
Mog T G 17: 37,323,264 (GRCm39) I225L probably benign Het
Mrgprx3-ps T A 7: 46,959,184 (GRCm39) noncoding transcript Het
Muc5b C T 7: 141,418,277 (GRCm39) S3741L probably benign Het
Myo5a A T 9: 75,037,402 (GRCm39) I202F probably damaging Het
Myo5b A T 18: 74,833,677 (GRCm39) I818F possibly damaging Het
Nfia T A 4: 97,902,534 (GRCm39) M262K probably damaging Het
Nisch C T 14: 30,928,524 (GRCm39) probably null Het
Nt5c2 T A 19: 46,881,999 (GRCm39) K284* probably null Het
Or14a259 A T 7: 86,013,398 (GRCm39) V49E possibly damaging Het
Or4k15b C A 14: 50,272,135 (GRCm39) A242S possibly damaging Het
Or4l1 A T 14: 50,166,236 (GRCm39) I255N probably damaging Het
Or52z14 T G 7: 103,252,996 (GRCm39) I45R probably benign Het
Or5an1c A G 19: 12,218,612 (GRCm39) S138P probably damaging Het
Or5j3 A T 2: 86,128,265 (GRCm39) Y35F probably damaging Het
Or8g55 A T 9: 39,784,741 (GRCm39) T57S possibly damaging Het
Or8k24 A T 2: 86,216,484 (GRCm39) S93T possibly damaging Het
Pcdhb17 A T 18: 37,619,878 (GRCm39) D556V probably damaging Het
Pcdhga8 A T 18: 37,859,673 (GRCm39) D243V probably benign Het
Polq A T 16: 36,909,681 (GRCm39) Q2355L probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc5a4a C A 10: 76,018,572 (GRCm39) Y506* probably null Het
Sp110 G C 1: 85,504,923 (GRCm39) probably benign Het
Tarbp1 G A 8: 127,193,895 (GRCm39) H336Y probably damaging Het
Tas2r134 T G 2: 51,517,559 (GRCm39) F13V probably benign Het
Tgfb2 A G 1: 186,436,680 (GRCm39) Y98H probably damaging Het
Tmprss11a C A 5: 86,559,665 (GRCm39) V376L probably damaging Het
Tmprss11f T A 5: 86,685,892 (GRCm39) K158N probably benign Het
Tnip2 G T 5: 34,660,922 (GRCm39) Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 (GRCm39) probably null Het
Ttc28 C T 5: 111,419,104 (GRCm39) P1398S probably benign Het
Umodl1 T G 17: 31,199,333 (GRCm39) I308S possibly damaging Het
Vcan A T 13: 89,839,719 (GRCm39) S1942T probably damaging Het
Vmn2r124 T A 17: 18,283,339 (GRCm39) N344K probably benign Het
Vmn2r25 C G 6: 123,802,277 (GRCm39) C542S probably damaging Het
Wiz T A 17: 32,597,470 (GRCm39) probably benign Het
Wrap73 A G 4: 154,239,803 (GRCm39) Y343C probably benign Het
Other mutations in Nkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Nkd1 APN 8 89,318,180 (GRCm39) splice site probably benign
IGL01724:Nkd1 APN 8 89,248,923 (GRCm39) missense probably damaging 0.98
IGL03297:Nkd1 APN 8 89,300,902 (GRCm39) splice site probably benign
PIT4508001:Nkd1 UTSW 8 89,249,028 (GRCm39) missense probably benign 0.04
R0350:Nkd1 UTSW 8 89,311,844 (GRCm39) nonsense probably null
R0611:Nkd1 UTSW 8 89,248,944 (GRCm39) missense probably damaging 1.00
R1080:Nkd1 UTSW 8 89,318,647 (GRCm39) missense probably benign 0.02
R1946:Nkd1 UTSW 8 89,318,745 (GRCm39) missense probably damaging 1.00
R2036:Nkd1 UTSW 8 89,318,305 (GRCm39) missense probably damaging 0.99
R2135:Nkd1 UTSW 8 89,318,278 (GRCm39) missense probably benign 0.06
R4623:Nkd1 UTSW 8 89,316,383 (GRCm39) missense probably benign 0.35
R6057:Nkd1 UTSW 8 89,316,442 (GRCm39) critical splice donor site probably null
R6168:Nkd1 UTSW 8 89,311,859 (GRCm39) missense probably damaging 1.00
R7424:Nkd1 UTSW 8 89,311,803 (GRCm39) missense probably benign 0.13
R9491:Nkd1 UTSW 8 89,300,875 (GRCm39) missense probably benign 0.33
R9784:Nkd1 UTSW 8 89,318,330 (GRCm39) missense probably damaging 1.00
X0024:Nkd1 UTSW 8 89,318,763 (GRCm39) missense probably damaging 1.00
Z1177:Nkd1 UTSW 8 89,318,679 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCACCCTGAATTCATGAG -3'
(R):5'- TCCCAGGCTGACTTAGATCC -3'

Sequencing Primer
(F):5'- AGCCACCCTGAATTCATGAGTTTAC -3'
(R):5'- AGGCTGACTTAGATCCTCCCTG -3'
Posted On 2016-07-06