Mutagenetix > Incidental Mutation

Incidental Mutation 'R5254:Myo5a'

399370

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

042825-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R5254 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75130120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 202 (I202F)

Ref Sequence

ENSEMBL: ENSMUSP00000117493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

AlphaFold

Q99104

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: I202F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: I202F

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

probably damaging
Transcript: ENSMUST00000136731
AA Change: I202F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: I202F

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136871

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: I202F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: I202F

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159458

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	G	T	8: 71,458,398	C296*	probably null	Het
Adam11	T	A	11: 102,774,272	Y413*	probably null	Het
Ankhd1	A	G	18: 36,656,715	I907V	probably benign	Het
Arrdc5	A	G	17: 56,297,897	I130T	probably benign	Het
Asic5	T	A	3: 82,020,987	I419K	probably damaging	Het
Atp4a	A	T	7: 30,715,530	E248V	probably damaging	Het
Avil	C	A	10: 127,011,761	V154L	probably benign	Het
Bclaf1	T	A	10: 20,323,536	H226Q	possibly damaging	Het
Cald1	A	G	6: 34,746,416		probably benign	Het
Cd200r4	A	C	16: 44,832,090	D27A	possibly damaging	Het
Cdsn	T	A	17: 35,552,202	M1K	probably null	Het
Cfap46	T	A	7: 139,678,514	H281L	possibly damaging	Het
Chaf1a	T	C	17: 56,062,606	F533L	probably benign	Het
Chil4	T	A	3: 106,219,452	I5F	probably benign	Het
Ctu2	A	T	8: 122,476,588	R48W	probably damaging	Het
Daam1	A	T	12: 71,946,576	H373L	unknown	Het
Dcaf10	T	A	4: 45,370,415	Y328N	possibly damaging	Het
Dst	A	T	1: 34,177,931	K1151*	probably null	Het
Ect2	T	C	3: 27,130,070	D503G	probably damaging	Het
Epm2a	C	A	10: 11,457,345	D307E	probably benign	Het
Exph5	A	T	9: 53,337,930	D73V	probably damaging	Het
Fam20b	C	T	1: 156,705,740	G102D	probably damaging	Het
Fat2	T	C	11: 55,281,175	N2904S	probably damaging	Het
Flt3	T	A	5: 147,375,690	Q147L	possibly damaging	Het
Fndc11	A	G	2: 181,222,163	T254A	possibly damaging	Het
Galnt15	C	T	14: 32,058,287	R514*	probably null	Het
Gbgt1	A	G	2: 28,505,208	D286G	probably damaging	Het
Ggt1	T	A	10: 75,579,198		probably null	Het
Gm26526	A	T	7: 39,589,234		noncoding transcript	Het
H2-K1	T	C	17: 33,997,462	T237A	probably damaging	Het
Igf1r	T	A	7: 68,207,319	S1010T	probably damaging	Het
Il21	T	C	3: 37,227,735	T87A	possibly damaging	Het
Kmt2b	G	A	7: 30,569,175	R2010C	probably damaging	Het
Kmt2c	G	A	5: 25,314,594	P2173S	probably benign	Het
Krt1	A	T	15: 101,846,368	S512T	unknown	Het
Krtap16-1	G	A	11: 99,985,598	R327*	probably null	Het
Lama1	T	A	17: 67,756,716	I745N	probably benign	Het
Lrrk1	T	A	7: 66,307,107	N372I	probably benign	Het
Lyst	A	T	13: 13,683,070	E2481D	probably benign	Het
Map2k1	A	T	9: 64,187,745		probably benign	Het
Mbip	A	G	12: 56,337,443	V215A	probably damaging	Het
Mdc1	T	A	17: 35,847,922	V398D	probably benign	Het
Mog	T	G	17: 37,012,372	I225L	probably benign	Het
Mrgprx3-ps	T	A	7: 47,309,436		noncoding transcript	Het
Muc5b	C	T	7: 141,864,540	S3741L	probably benign	Het
Myo5b	A	T	18: 74,700,606	I818F	possibly damaging	Het
Nfia	T	A	4: 98,014,297	M262K	probably damaging	Het
Nisch	C	T	14: 31,206,567		probably null	Het
Nkd1	A	G	8: 88,589,194	D64G	probably damaging	Het
Nt5c2	T	A	19: 46,893,560	K284*	probably null	Het
Olfr1052	A	T	2: 86,297,921	Y35F	probably damaging	Het
Olfr1058	A	T	2: 86,386,140	S93T	possibly damaging	Het
Olfr262	A	G	19: 12,241,248	S138P	probably damaging	Het
Olfr305	A	T	7: 86,364,190	V49E	possibly damaging	Het
Olfr619	T	G	7: 103,603,789	I45R	probably benign	Het
Olfr723	A	T	14: 49,928,779	I255N	probably damaging	Het
Olfr725	C	A	14: 50,034,678	A242S	possibly damaging	Het
Olfr972	A	T	9: 39,873,445	T57S	possibly damaging	Het
Pcdhb17	A	T	18: 37,486,825	D556V	probably damaging	Het
Pcdhga8	A	T	18: 37,726,620	D243V	probably benign	Het
Polq	A	T	16: 37,089,319	Q2355L	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc5a4a	C	A	10: 76,182,738	Y506*	probably null	Het
Sp110	G	C	1: 85,577,202		probably benign	Het
Tarbp1	G	A	8: 126,467,156	H336Y	probably damaging	Het
Tas2r134	T	G	2: 51,627,547	F13V	probably benign	Het
Tgfb2	A	G	1: 186,704,483	Y98H	probably damaging	Het
Tmprss11a	C	A	5: 86,411,806	V376L	probably damaging	Het
Tmprss11f	T	A	5: 86,538,033	K158N	probably benign	Het
Tnip2	G	T	5: 34,503,578	Q177K	probably damaging	Het
Trp53inp1	T	A	4: 11,165,075		probably null	Het
Ttc28	C	T	5: 111,271,238	P1398S	probably benign	Het
Umodl1	T	G	17: 30,980,359	I308S	possibly damaging	Het
Vcan	A	T	13: 89,691,600	S1942T	probably damaging	Het
Vmn2r124	T	A	17: 18,063,077	N344K	probably benign	Het
Vmn2r25	C	G	6: 123,825,318	C542S	probably damaging	Het
Wiz	T	A	17: 32,378,496		probably benign	Het
Wrap73	A	G	4: 154,155,346	Y343C	probably benign	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211126	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
R9644:Myo5a	UTSW	9	75136349	missense	probably damaging	1.00
R9649:Myo5a	UTSW	9	75192444	missense
R9748:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9766:Myo5a	UTSW	9	75171632	missense	probably damaging	0.99
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- GGCACAAAAGTGGCCATGTC -3'
(R):5'- GAAATACCAACCTTACCGAGTTTTC -3'

Sequencing Primer
(F):5'- TGGACGCACTGAAAGTCACTTTG -3'
(R):5'- AACCTTACCGAGTTTTCAGCTTTC -3'

Posted On

2016-07-06