Mutagenetix > Incidental Mutation

Incidental Mutation 'R5254:Avil'

399379

Institutional Source

Beutler Lab

Gene Symbol

Avil

Ensembl Gene

ENSMUSG00000025432

Gene Name

advillin

Synonyms

DOC6

MMRRC Submission

042825-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R5254 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127000709-127020994 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 127011761 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 154 (V154L)

Ref Sequence

ENSEMBL: ENSMUSP00000122669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000129173] [ENSMUST00000152054]

AlphaFold

O88398

Predicted Effect

probably benign
Transcript: ENSMUST00000026500
AA Change: H518Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: H518Q

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129173
AA Change: H518Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: H518Q

Domain	Start	End	E-Value	Type
GEL	14	111	9.44e-24	SMART
GEL	132	226	8.89e-20	SMART
GEL	253	346	1.19e-29	SMART
GEL	395	492	2.07e-29	SMART
GEL	512	598	4.01e-27	SMART
GEL	617	711	2.81e-31	SMART
VHP	784	819	1.31e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000152054
AA Change: V154L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521
AA Change: V154L

Domain	Start	End	E-Value	Type
Pfam:UBA	44	81	1.2e-10	PFAM
SCOP:d1efub4	101	120	5e-4	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	G	T	8: 71,458,398	C296*	probably null	Het
Adam11	T	A	11: 102,774,272	Y413*	probably null	Het
Ankhd1	A	G	18: 36,656,715	I907V	probably benign	Het
Arrdc5	A	G	17: 56,297,897	I130T	probably benign	Het
Asic5	T	A	3: 82,020,987	I419K	probably damaging	Het
Atp4a	A	T	7: 30,715,530	E248V	probably damaging	Het
Bclaf1	T	A	10: 20,323,536	H226Q	possibly damaging	Het
Cald1	A	G	6: 34,746,416		probably benign	Het
Cd200r4	A	C	16: 44,832,090	D27A	possibly damaging	Het
Cdsn	T	A	17: 35,552,202	M1K	probably null	Het
Cfap46	T	A	7: 139,678,514	H281L	possibly damaging	Het
Chaf1a	T	C	17: 56,062,606	F533L	probably benign	Het
Chil4	T	A	3: 106,219,452	I5F	probably benign	Het
Ctu2	A	T	8: 122,476,588	R48W	probably damaging	Het
Daam1	A	T	12: 71,946,576	H373L	unknown	Het
Dcaf10	T	A	4: 45,370,415	Y328N	possibly damaging	Het
Dst	A	T	1: 34,177,931	K1151*	probably null	Het
Ect2	T	C	3: 27,130,070	D503G	probably damaging	Het
Epm2a	C	A	10: 11,457,345	D307E	probably benign	Het
Exph5	A	T	9: 53,337,930	D73V	probably damaging	Het
Fam20b	C	T	1: 156,705,740	G102D	probably damaging	Het
Fat2	T	C	11: 55,281,175	N2904S	probably damaging	Het
Flt3	T	A	5: 147,375,690	Q147L	possibly damaging	Het
Fndc11	A	G	2: 181,222,163	T254A	possibly damaging	Het
Galnt15	C	T	14: 32,058,287	R514*	probably null	Het
Gbgt1	A	G	2: 28,505,208	D286G	probably damaging	Het
Ggt1	T	A	10: 75,579,198		probably null	Het
Gm26526	A	T	7: 39,589,234		noncoding transcript	Het
H2-K1	T	C	17: 33,997,462	T237A	probably damaging	Het
Igf1r	T	A	7: 68,207,319	S1010T	probably damaging	Het
Il21	T	C	3: 37,227,735	T87A	possibly damaging	Het
Kmt2b	G	A	7: 30,569,175	R2010C	probably damaging	Het
Kmt2c	G	A	5: 25,314,594	P2173S	probably benign	Het
Krt1	A	T	15: 101,846,368	S512T	unknown	Het
Krtap16-1	G	A	11: 99,985,598	R327*	probably null	Het
Lama1	T	A	17: 67,756,716	I745N	probably benign	Het
Lrrk1	T	A	7: 66,307,107	N372I	probably benign	Het
Lyst	A	T	13: 13,683,070	E2481D	probably benign	Het
Map2k1	A	T	9: 64,187,745		probably benign	Het
Mbip	A	G	12: 56,337,443	V215A	probably damaging	Het
Mdc1	T	A	17: 35,847,922	V398D	probably benign	Het
Mog	T	G	17: 37,012,372	I225L	probably benign	Het
Mrgprx3-ps	T	A	7: 47,309,436		noncoding transcript	Het
Muc5b	C	T	7: 141,864,540	S3741L	probably benign	Het
Myo5a	A	T	9: 75,130,120	I202F	probably damaging	Het
Myo5b	A	T	18: 74,700,606	I818F	possibly damaging	Het
Nfia	T	A	4: 98,014,297	M262K	probably damaging	Het
Nisch	C	T	14: 31,206,567		probably null	Het
Nkd1	A	G	8: 88,589,194	D64G	probably damaging	Het
Nt5c2	T	A	19: 46,893,560	K284*	probably null	Het
Olfr1052	A	T	2: 86,297,921	Y35F	probably damaging	Het
Olfr1058	A	T	2: 86,386,140	S93T	possibly damaging	Het
Olfr262	A	G	19: 12,241,248	S138P	probably damaging	Het
Olfr305	A	T	7: 86,364,190	V49E	possibly damaging	Het
Olfr619	T	G	7: 103,603,789	I45R	probably benign	Het
Olfr723	A	T	14: 49,928,779	I255N	probably damaging	Het
Olfr725	C	A	14: 50,034,678	A242S	possibly damaging	Het
Olfr972	A	T	9: 39,873,445	T57S	possibly damaging	Het
Pcdhb17	A	T	18: 37,486,825	D556V	probably damaging	Het
Pcdhga8	A	T	18: 37,726,620	D243V	probably benign	Het
Polq	A	T	16: 37,089,319	Q2355L	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc5a4a	C	A	10: 76,182,738	Y506*	probably null	Het
Sp110	G	C	1: 85,577,202		probably benign	Het
Tarbp1	G	A	8: 126,467,156	H336Y	probably damaging	Het
Tas2r134	T	G	2: 51,627,547	F13V	probably benign	Het
Tgfb2	A	G	1: 186,704,483	Y98H	probably damaging	Het
Tmprss11a	C	A	5: 86,411,806	V376L	probably damaging	Het
Tmprss11f	T	A	5: 86,538,033	K158N	probably benign	Het
Tnip2	G	T	5: 34,503,578	Q177K	probably damaging	Het
Trp53inp1	T	A	4: 11,165,075		probably null	Het
Ttc28	C	T	5: 111,271,238	P1398S	probably benign	Het
Umodl1	T	G	17: 30,980,359	I308S	possibly damaging	Het
Vcan	A	T	13: 89,691,600	S1942T	probably damaging	Het
Vmn2r124	T	A	17: 18,063,077	N344K	probably benign	Het
Vmn2r25	C	G	6: 123,825,318	C542S	probably damaging	Het
Wiz	T	A	17: 32,378,496		probably benign	Het
Wrap73	A	G	4: 154,155,346	Y343C	probably benign	Het

Other mutations in Avil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Avil	APN	10	127017034	critical splice donor site	probably null
IGL01893:Avil	APN	10	127020546	missense	possibly damaging	0.73
IGL02127:Avil	APN	10	127011826	missense	probably benign	0.13
IGL02425:Avil	APN	10	127018447	missense	probably benign
IGL02458:Avil	APN	10	127016353	missense	probably benign	0.00
IGL02707:Avil	APN	10	127006562	missense	probably damaging	1.00
IGL02805:Avil	APN	10	127007617	missense	possibly damaging	0.79
IGL02836:Avil	APN	10	127008995	missense	probably damaging	1.00
IGL02961:Avil	APN	10	127008306	missense	probably benign	0.00
IGL03025:Avil	APN	10	127013577	missense	probably benign	0.19
IGL03083:Avil	APN	10	127016324	missense	probably benign	0.31
IGL03345:Avil	APN	10	127008957	unclassified	probably benign
IGL03365:Avil	APN	10	127010983	missense	probably damaging	1.00
R0109:Avil	UTSW	10	127013644	missense	probably benign
R0109:Avil	UTSW	10	127013644	missense	probably benign
R1159:Avil	UTSW	10	127011790	missense	possibly damaging	0.94
R1631:Avil	UTSW	10	127010625	splice site	probably null
R2026:Avil	UTSW	10	127011873	missense	probably damaging	1.00
R3694:Avil	UTSW	10	127008330	missense	probably damaging	0.98
R3948:Avil	UTSW	10	127014205	missense	probably benign	0.00
R4165:Avil	UTSW	10	127006627	nonsense	probably null
R4978:Avil	UTSW	10	127018396	missense	probably benign	0.09
R5159:Avil	UTSW	10	127020448	critical splice acceptor site	probably null
R5285:Avil	UTSW	10	127018459	missense	probably damaging	0.97
R5618:Avil	UTSW	10	127010577	missense	possibly damaging	0.79
R5682:Avil	UTSW	10	127014104	missense	probably damaging	1.00
R5786:Avil	UTSW	10	127016499	critical splice donor site	probably null
R5819:Avil	UTSW	10	127009998	missense	probably damaging	1.00
R6149:Avil	UTSW	10	127006582	missense	probably benign	0.25
R6631:Avil	UTSW	10	127007749	missense	possibly damaging	0.52
R6665:Avil	UTSW	10	127020525	missense	probably damaging	1.00
R6745:Avil	UTSW	10	127014119	missense	probably benign	0.00
R6804:Avil	UTSW	10	127008306	nonsense	probably null
R6838:Avil	UTSW	10	127013562	missense	probably benign
R7481:Avil	UTSW	10	127007591	missense	probably benign	0.33
R8213:Avil	UTSW	10	127008321	missense	probably damaging	0.97
R8349:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8449:Avil	UTSW	10	127009992	missense	probably benign	0.00
R8510:Avil	UTSW	10	127009781	missense	probably benign	0.03
R8849:Avil	UTSW	10	127008792	missense	possibly damaging	0.91
R8944:Avil	UTSW	10	127010586	missense	probably damaging	1.00
R9101:Avil	UTSW	10	127017004	missense	probably benign	0.06
R9176:Avil	UTSW	10	127016379	missense	probably damaging	1.00
R9733:Avil	UTSW	10	127007842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGAATAATACCTGCTCCG -3'
(R):5'- AGTCGTGACTCCCAACTGAC -3'

Sequencing Primer
(F):5'- TCCGCAGAATTACTCGAGGTCAG -3'
(R):5'- GTGACTCCCAACTGACCAACTAGTAG -3'

Posted On

2016-07-06