Incidental Mutation 'R5254:Avil'
ID 399379
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Name advillin
Synonyms DOC6
MMRRC Submission 042825-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R5254 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 126836578-126856863 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 126847630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 154 (V154L)
Ref Sequence ENSEMBL: ENSMUSP00000122669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000129173] [ENSMUST00000152054]
AlphaFold O88398
Predicted Effect probably benign
Transcript: ENSMUST00000026500
AA Change: H518Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: H518Q

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129173
AA Change: H518Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: H518Q

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152054
AA Change: V154L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521
AA Change: V154L

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,911,042 (GRCm39) C296* probably null Het
Adam11 T A 11: 102,665,098 (GRCm39) Y413* probably null Het
Ankhd1 A G 18: 36,789,768 (GRCm39) I907V probably benign Het
Arrdc5 A G 17: 56,604,897 (GRCm39) I130T probably benign Het
Asic5 T A 3: 81,928,294 (GRCm39) I419K probably damaging Het
Atp4a A T 7: 30,414,955 (GRCm39) E248V probably damaging Het
Bclaf1 T A 10: 20,199,282 (GRCm39) H226Q possibly damaging Het
Cald1 A G 6: 34,723,351 (GRCm39) probably benign Het
Cd200r4 A C 16: 44,652,453 (GRCm39) D27A possibly damaging Het
Cdsn T A 17: 35,863,099 (GRCm39) M1K probably null Het
Cfap46 T A 7: 139,258,430 (GRCm39) H281L possibly damaging Het
Chaf1a T C 17: 56,369,606 (GRCm39) F533L probably benign Het
Chil4 T A 3: 106,126,768 (GRCm39) I5F probably benign Het
Ctu2 A T 8: 123,203,327 (GRCm39) R48W probably damaging Het
Daam1 A T 12: 71,993,350 (GRCm39) H373L unknown Het
Dcaf10 T A 4: 45,370,415 (GRCm39) Y328N possibly damaging Het
Dst A T 1: 34,217,012 (GRCm39) K1151* probably null Het
Ect2 T C 3: 27,184,219 (GRCm39) D503G probably damaging Het
Epm2a C A 10: 11,333,089 (GRCm39) D307E probably benign Het
Exph5 A T 9: 53,249,230 (GRCm39) D73V probably damaging Het
Fam20b C T 1: 156,533,310 (GRCm39) G102D probably damaging Het
Fat2 T C 11: 55,172,001 (GRCm39) N2904S probably damaging Het
Flt3 T A 5: 147,312,500 (GRCm39) Q147L possibly damaging Het
Fndc11 A G 2: 180,863,956 (GRCm39) T254A possibly damaging Het
Galnt15 C T 14: 31,780,244 (GRCm39) R514* probably null Het
Gbgt1 A G 2: 28,395,220 (GRCm39) D286G probably damaging Het
Ggt1 T A 10: 75,415,032 (GRCm39) probably null Het
Gm26526 A T 7: 39,238,658 (GRCm39) noncoding transcript Het
H2-K2 T C 17: 34,216,436 (GRCm39) T237A probably damaging Het
Igf1r T A 7: 67,857,067 (GRCm39) S1010T probably damaging Het
Il21 T C 3: 37,281,884 (GRCm39) T87A possibly damaging Het
Kmt2b G A 7: 30,268,600 (GRCm39) R2010C probably damaging Het
Kmt2c G A 5: 25,519,592 (GRCm39) P2173S probably benign Het
Krt1 A T 15: 101,754,803 (GRCm39) S512T unknown Het
Krtap16-1 G A 11: 99,876,424 (GRCm39) R327* probably null Het
Lama1 T A 17: 68,063,711 (GRCm39) I745N probably benign Het
Lrrk1 T A 7: 65,956,855 (GRCm39) N372I probably benign Het
Lyst A T 13: 13,857,655 (GRCm39) E2481D probably benign Het
Map2k1 A T 9: 64,095,027 (GRCm39) probably benign Het
Mbip A G 12: 56,384,228 (GRCm39) V215A probably damaging Het
Mdc1 T A 17: 36,158,814 (GRCm39) V398D probably benign Het
Mog T G 17: 37,323,264 (GRCm39) I225L probably benign Het
Mrgprx3-ps T A 7: 46,959,184 (GRCm39) noncoding transcript Het
Muc5b C T 7: 141,418,277 (GRCm39) S3741L probably benign Het
Myo5a A T 9: 75,037,402 (GRCm39) I202F probably damaging Het
Myo5b A T 18: 74,833,677 (GRCm39) I818F possibly damaging Het
Nfia T A 4: 97,902,534 (GRCm39) M262K probably damaging Het
Nisch C T 14: 30,928,524 (GRCm39) probably null Het
Nkd1 A G 8: 89,315,822 (GRCm39) D64G probably damaging Het
Nt5c2 T A 19: 46,881,999 (GRCm39) K284* probably null Het
Or14a259 A T 7: 86,013,398 (GRCm39) V49E possibly damaging Het
Or4k15b C A 14: 50,272,135 (GRCm39) A242S possibly damaging Het
Or4l1 A T 14: 50,166,236 (GRCm39) I255N probably damaging Het
Or52z14 T G 7: 103,252,996 (GRCm39) I45R probably benign Het
Or5an1c A G 19: 12,218,612 (GRCm39) S138P probably damaging Het
Or5j3 A T 2: 86,128,265 (GRCm39) Y35F probably damaging Het
Or8g55 A T 9: 39,784,741 (GRCm39) T57S possibly damaging Het
Or8k24 A T 2: 86,216,484 (GRCm39) S93T possibly damaging Het
Pcdhb17 A T 18: 37,619,878 (GRCm39) D556V probably damaging Het
Pcdhga8 A T 18: 37,859,673 (GRCm39) D243V probably benign Het
Polq A T 16: 36,909,681 (GRCm39) Q2355L probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc5a4a C A 10: 76,018,572 (GRCm39) Y506* probably null Het
Sp110 G C 1: 85,504,923 (GRCm39) probably benign Het
Tarbp1 G A 8: 127,193,895 (GRCm39) H336Y probably damaging Het
Tas2r134 T G 2: 51,517,559 (GRCm39) F13V probably benign Het
Tgfb2 A G 1: 186,436,680 (GRCm39) Y98H probably damaging Het
Tmprss11a C A 5: 86,559,665 (GRCm39) V376L probably damaging Het
Tmprss11f T A 5: 86,685,892 (GRCm39) K158N probably benign Het
Tnip2 G T 5: 34,660,922 (GRCm39) Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 (GRCm39) probably null Het
Ttc28 C T 5: 111,419,104 (GRCm39) P1398S probably benign Het
Umodl1 T G 17: 31,199,333 (GRCm39) I308S possibly damaging Het
Vcan A T 13: 89,839,719 (GRCm39) S1942T probably damaging Het
Vmn2r124 T A 17: 18,283,339 (GRCm39) N344K probably benign Het
Vmn2r25 C G 6: 123,802,277 (GRCm39) C542S probably damaging Het
Wiz T A 17: 32,597,470 (GRCm39) probably benign Het
Wrap73 A G 4: 154,239,803 (GRCm39) Y343C probably benign Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 126,852,903 (GRCm39) critical splice donor site probably null
IGL01893:Avil APN 10 126,856,415 (GRCm39) missense possibly damaging 0.73
IGL02127:Avil APN 10 126,847,695 (GRCm39) missense probably benign 0.13
IGL02425:Avil APN 10 126,854,316 (GRCm39) missense probably benign
IGL02458:Avil APN 10 126,852,222 (GRCm39) missense probably benign 0.00
IGL02707:Avil APN 10 126,842,431 (GRCm39) missense probably damaging 1.00
IGL02805:Avil APN 10 126,843,486 (GRCm39) missense possibly damaging 0.79
IGL02836:Avil APN 10 126,844,864 (GRCm39) missense probably damaging 1.00
IGL02961:Avil APN 10 126,844,175 (GRCm39) missense probably benign 0.00
IGL03025:Avil APN 10 126,849,446 (GRCm39) missense probably benign 0.19
IGL03083:Avil APN 10 126,852,193 (GRCm39) missense probably benign 0.31
IGL03345:Avil APN 10 126,844,826 (GRCm39) unclassified probably benign
IGL03365:Avil APN 10 126,846,852 (GRCm39) missense probably damaging 1.00
R0109:Avil UTSW 10 126,849,513 (GRCm39) missense probably benign
R0109:Avil UTSW 10 126,849,513 (GRCm39) missense probably benign
R1159:Avil UTSW 10 126,847,659 (GRCm39) missense possibly damaging 0.94
R1631:Avil UTSW 10 126,846,494 (GRCm39) splice site probably null
R2026:Avil UTSW 10 126,847,742 (GRCm39) missense probably damaging 1.00
R3694:Avil UTSW 10 126,844,199 (GRCm39) missense probably damaging 0.98
R3948:Avil UTSW 10 126,850,074 (GRCm39) missense probably benign 0.00
R4165:Avil UTSW 10 126,842,496 (GRCm39) nonsense probably null
R4978:Avil UTSW 10 126,854,265 (GRCm39) missense probably benign 0.09
R5159:Avil UTSW 10 126,856,317 (GRCm39) critical splice acceptor site probably null
R5285:Avil UTSW 10 126,854,328 (GRCm39) missense probably damaging 0.97
R5618:Avil UTSW 10 126,846,446 (GRCm39) missense possibly damaging 0.79
R5682:Avil UTSW 10 126,849,973 (GRCm39) missense probably damaging 1.00
R5786:Avil UTSW 10 126,852,368 (GRCm39) critical splice donor site probably null
R5819:Avil UTSW 10 126,845,867 (GRCm39) missense probably damaging 1.00
R6149:Avil UTSW 10 126,842,451 (GRCm39) missense probably benign 0.25
R6631:Avil UTSW 10 126,843,618 (GRCm39) missense possibly damaging 0.52
R6665:Avil UTSW 10 126,856,394 (GRCm39) missense probably damaging 1.00
R6745:Avil UTSW 10 126,849,988 (GRCm39) missense probably benign 0.00
R6804:Avil UTSW 10 126,844,175 (GRCm39) nonsense probably null
R6838:Avil UTSW 10 126,849,431 (GRCm39) missense probably benign
R7481:Avil UTSW 10 126,843,460 (GRCm39) missense probably benign 0.33
R8213:Avil UTSW 10 126,844,190 (GRCm39) missense probably damaging 0.97
R8349:Avil UTSW 10 126,845,861 (GRCm39) missense probably benign 0.00
R8449:Avil UTSW 10 126,845,861 (GRCm39) missense probably benign 0.00
R8510:Avil UTSW 10 126,845,650 (GRCm39) missense probably benign 0.03
R8849:Avil UTSW 10 126,844,661 (GRCm39) missense possibly damaging 0.91
R8944:Avil UTSW 10 126,846,455 (GRCm39) missense probably damaging 1.00
R9101:Avil UTSW 10 126,852,873 (GRCm39) missense probably benign 0.06
R9176:Avil UTSW 10 126,852,248 (GRCm39) missense probably damaging 1.00
R9733:Avil UTSW 10 126,843,711 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGAATAATACCTGCTCCG -3'
(R):5'- AGTCGTGACTCCCAACTGAC -3'

Sequencing Primer
(F):5'- TCCGCAGAATTACTCGAGGTCAG -3'
(R):5'- GTGACTCCCAACTGACCAACTAGTAG -3'
Posted On 2016-07-06