Incidental Mutation 'R5179:Bhlhe40'
ID 399382
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 042759-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5179 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108642169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 371 (I371T)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect possibly damaging
Transcript: ENSMUST00000032194
AA Change: I371T

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: I371T

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.0829 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B9d2 C A 7: 25,380,826 (GRCm39) H5Q probably damaging Het
Bmp8a C T 4: 123,207,094 (GRCm39) R389H probably damaging Het
Cc2d2a T A 5: 43,845,563 (GRCm39) N326K possibly damaging Het
Ccdc154 A G 17: 25,390,137 (GRCm39) N545S probably benign Het
Ccser2 A T 14: 36,601,308 (GRCm39) S359T possibly damaging Het
Cd22 T A 7: 30,575,299 (GRCm39) T248S possibly damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dnhd1 T C 7: 105,363,759 (GRCm39) I4107T probably damaging Het
Egf T A 3: 129,479,936 (GRCm39) H488L probably damaging Het
Epb41l4b A G 4: 57,063,181 (GRCm39) V503A probably benign Het
Exd2 G T 12: 80,531,118 (GRCm39) W105L probably damaging Het
Flrt2 A T 12: 95,747,121 (GRCm39) R486S probably benign Het
Gadl1 C A 9: 115,789,448 (GRCm39) C251* probably null Het
Ifit2 C A 19: 34,550,976 (GRCm39) P172Q probably damaging Het
Incenp G C 19: 9,872,273 (GRCm39) Q62E unknown Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Lrg1 A G 17: 56,427,795 (GRCm39) L59P possibly damaging Het
Luc7l3 T C 11: 94,190,879 (GRCm39) E145G possibly damaging Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Ndst3 A G 3: 123,346,181 (GRCm39) S698P probably damaging Het
Nploc4 T C 11: 120,299,682 (GRCm39) D346G probably benign Het
Or4m1 G A 14: 50,557,993 (GRCm39) Q100* probably null Het
Or56b1b T C 7: 108,164,433 (GRCm39) I190V probably benign Het
Osbpl8 T G 10: 111,108,025 (GRCm39) D298E probably benign Het
Pcna-ps2 T C 19: 9,260,891 (GRCm39) L50P probably damaging Het
Ptgir C T 7: 16,641,253 (GRCm39) P182S probably damaging Het
Rictor A G 15: 6,825,421 (GRCm39) Y1653C probably damaging Het
Sgcd T A 11: 46,871,711 (GRCm39) E208V probably benign Het
Slc7a8 A T 14: 54,962,289 (GRCm39) C448* probably null Het
Sos2 G A 12: 69,697,502 (GRCm39) R73* probably null Het
Tecpr2 A G 12: 110,911,127 (GRCm39) T1055A possibly damaging Het
Usp47 T C 7: 111,692,639 (GRCm39) Y1014H probably damaging Het
Vmn2r6 A T 3: 64,445,411 (GRCm39) F682L probably benign Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTGATCTGATGGGTTCCCC -3'
(R):5'- CTGATCTCTCTGCACTCAGG -3'

Sequencing Primer
(F):5'- CCATTTCTTGGGCCACACC -3'
(R):5'- GTGGTTTTTGGAATTAGGGAGGAAAG -3'
Posted On 2016-07-06