Incidental Mutation 'R5179:Cd22'
ID399388
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene NameCD22 antigen
SynonymsLyb-8, Lyb8
MMRRC Submission 042759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5179 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30865402-30880342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30875874 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 248 (T248S)
Ref Sequence ENSEMBL: ENSMUSP00000140528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000188157] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289] [ENSMUST00000190753]
Predicted Effect probably benign
Transcript: ENSMUST00000019248
AA Change: T248S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: T248S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108125
AA Change: T248S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: T248S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186154
AA Change: T248S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: T248S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187585
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably benign
Transcript: ENSMUST00000188157
SMART Domains Protein: ENSMUSP00000140450
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189718
AA Change: T248S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: T248S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect probably benign
Transcript: ENSMUST00000190617
AA Change: T248S

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: T248S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190646
AA Change: T248S

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577
AA Change: T248S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190170
Predicted Effect probably benign
Transcript: ENSMUST00000214289
AA Change: T248S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000190753
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Meta Mutation Damage Score 0.1247 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B9d2 C A 7: 25,681,401 H5Q probably damaging Het
Bhlhe40 T C 6: 108,665,208 I371T possibly damaging Het
Bmp8a C T 4: 123,313,301 R389H probably damaging Het
Cc2d2a T A 5: 43,688,221 N326K possibly damaging Het
Ccdc154 A G 17: 25,171,163 N545S probably benign Het
Ccser2 A T 14: 36,879,351 S359T possibly damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dnhd1 T C 7: 105,714,552 I4107T probably damaging Het
Egf T A 3: 129,686,287 H488L probably damaging Het
Epb41l4b A G 4: 57,063,181 V503A probably benign Het
Exd2 G T 12: 80,484,344 W105L probably damaging Het
Flrt2 A T 12: 95,780,347 R486S probably benign Het
Gadl1 C A 9: 115,960,380 C251* probably null Het
Ifit2 C A 19: 34,573,576 P172Q probably damaging Het
Incenp G C 19: 9,894,909 Q62E unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrg1 A G 17: 56,120,795 L59P possibly damaging Het
Luc7l3 T C 11: 94,300,053 E145G possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nploc4 T C 11: 120,408,856 D346G probably benign Het
Olfr504 T C 7: 108,565,226 I190V probably benign Het
Olfr734 G A 14: 50,320,536 Q100* probably null Het
Osbpl8 T G 10: 111,272,164 D298E probably benign Het
Pcna-ps2 T C 19: 9,283,527 L50P probably damaging Het
Ptgir C T 7: 16,907,328 P182S probably damaging Het
Rictor A G 15: 6,795,940 Y1653C probably damaging Het
Sgcd T A 11: 46,980,884 E208V probably benign Het
Slc7a8 A T 14: 54,724,832 C448* probably null Het
Sos2 G A 12: 69,650,728 R73* probably null Het
Tecpr2 A G 12: 110,944,693 T1055A possibly damaging Het
Usp47 T C 7: 112,093,432 Y1014H probably damaging Het
Vmn2r6 A T 3: 64,537,990 F682L probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
crullers UTSW 7 30869883 missense probably damaging 1.00
gansu UTSW 7 30870105 missense probably damaging 1.00
lacrima UTSW 7 30876153 missense probably damaging 1.00
Lluvia UTSW 7 30870487 missense possibly damaging 0.48
Mist UTSW 7 30866658 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense probably null
Yosemite UTSW 7 30869509 critical splice donor site probably null
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30869509 critical splice donor site probably null
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 synonymous probably null
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5456:Cd22 UTSW 7 30876039 missense probably benign 0.02
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30878079 missense probably benign 0.03
R7083:Cd22 UTSW 7 30868048 missense probably damaging 0.99
R7225:Cd22 UTSW 7 30877634 missense not run
R7732:Cd22 UTSW 7 30870057 missense probably damaging 1.00
X0025:Cd22 UTSW 7 30873419 unclassified probably null
Z1176:Cd22 UTSW 7 30867963 missense probably benign 0.03
Z1176:Cd22 UTSW 7 30869530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTCAGGCCAAGGCAGAG -3'
(R):5'- TAGAAGATTCTGAGATCACCTCCATC -3'

Sequencing Primer
(F):5'- GGCTAAAATGAACCTGTGTCTTGAG -3'
(R):5'- GATTCTGAGATCACCTCCATCACCTC -3'
Posted On2016-07-06