Incidental Mutation 'R5254:Krt1'
ID399397
Institutional Source Beutler Lab
Gene Symbol Krt1
Ensembl Gene ENSMUSG00000046834
Gene Namekeratin 1
SynonymsKrt-2.1, Krt2-1
MMRRC Submission 042825-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R5254 (G1)
Quality Score201
Status Validated
Chromosome15
Chromosomal Location101845426-101850794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101846368 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 512 (S512T)
Ref Sequence ENSEMBL: ENSMUSP00000023790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023790] [ENSMUST00000023790]
Predicted Effect unknown
Transcript: ENSMUST00000023790
AA Change: S512T
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834
AA Change: S512T

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000023790
AA Change: S512T
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834
AA Change: S512T

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231047
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,458,398 C296* probably null Het
Adam11 T A 11: 102,774,272 Y413* probably null Het
Ankhd1 A G 18: 36,656,715 I907V probably benign Het
Arrdc5 A G 17: 56,297,897 I130T probably benign Het
Asic5 T A 3: 82,020,987 I419K probably damaging Het
Atp4a A T 7: 30,715,530 E248V probably damaging Het
Avil C A 10: 127,011,761 V154L probably benign Het
Bclaf1 T A 10: 20,323,536 H226Q possibly damaging Het
Cald1 A G 6: 34,746,416 probably benign Het
Cd200r4 A C 16: 44,832,090 D27A possibly damaging Het
Cdsn T A 17: 35,552,202 M1K probably null Het
Cfap46 T A 7: 139,678,514 H281L possibly damaging Het
Chaf1a T C 17: 56,062,606 F533L probably benign Het
Chil4 T A 3: 106,219,452 I5F probably benign Het
Ctu2 A T 8: 122,476,588 R48W probably damaging Het
Daam1 A T 12: 71,946,576 H373L unknown Het
Dcaf10 T A 4: 45,370,415 Y328N possibly damaging Het
Dst A T 1: 34,177,931 K1151* probably null Het
Ect2 T C 3: 27,130,070 D503G probably damaging Het
Epm2a C A 10: 11,457,345 D307E probably benign Het
Exph5 A T 9: 53,337,930 D73V probably damaging Het
Fam20b C T 1: 156,705,740 G102D probably damaging Het
Fat2 T C 11: 55,281,175 N2904S probably damaging Het
Flt3 T A 5: 147,375,690 Q147L possibly damaging Het
Fndc11 A G 2: 181,222,163 T254A possibly damaging Het
Galnt15 C T 14: 32,058,287 R514* probably null Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Ggt1 T A 10: 75,579,198 probably null Het
Gm26526 A T 7: 39,589,234 noncoding transcript Het
H2-K1 T C 17: 33,997,462 T237A probably damaging Het
Igf1r T A 7: 68,207,319 S1010T probably damaging Het
Il21 T C 3: 37,227,735 T87A possibly damaging Het
Kmt2b G A 7: 30,569,175 R2010C probably damaging Het
Kmt2c G A 5: 25,314,594 P2173S probably benign Het
Krtap16-1 G A 11: 99,985,598 R327* probably null Het
Lama1 T A 17: 67,756,716 I745N probably benign Het
Lrrk1 T A 7: 66,307,107 N372I probably benign Het
Lyst A T 13: 13,683,070 E2481D probably benign Het
Map2k1 A T 9: 64,187,745 probably benign Het
Mbip A G 12: 56,337,443 V215A probably damaging Het
Mdc1 T A 17: 35,847,922 V398D probably benign Het
Mog T G 17: 37,012,372 I225L probably benign Het
Mrgprx3-ps T A 7: 47,309,436 noncoding transcript Het
Muc5b C T 7: 141,864,540 S3741L probably benign Het
Myo5a A T 9: 75,130,120 I202F probably damaging Het
Myo5b A T 18: 74,700,606 I818F possibly damaging Het
Nfia T A 4: 98,014,297 M262K probably damaging Het
Nisch C T 14: 31,206,567 probably null Het
Nkd1 A G 8: 88,589,194 D64G probably damaging Het
Nt5c2 T A 19: 46,893,560 K284* probably null Het
Olfr1052 A T 2: 86,297,921 Y35F probably damaging Het
Olfr1058 A T 2: 86,386,140 S93T possibly damaging Het
Olfr262 A G 19: 12,241,248 S138P probably damaging Het
Olfr305 A T 7: 86,364,190 V49E possibly damaging Het
Olfr619 T G 7: 103,603,789 I45R probably benign Het
Olfr723 A T 14: 49,928,779 I255N probably damaging Het
Olfr725 C A 14: 50,034,678 A242S possibly damaging Het
Olfr972 A T 9: 39,873,445 T57S possibly damaging Het
Pcdhb17 A T 18: 37,486,825 D556V probably damaging Het
Pcdhga8 A T 18: 37,726,620 D243V probably benign Het
Polq A T 16: 37,089,319 Q2355L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc5a4a C A 10: 76,182,738 Y506* probably null Het
Sp110 G C 1: 85,577,202 probably benign Het
Tarbp1 G A 8: 126,467,156 H336Y probably damaging Het
Tas2r134 T G 2: 51,627,547 F13V probably benign Het
Tgfb2 A G 1: 186,704,483 Y98H probably damaging Het
Tmprss11a C A 5: 86,411,806 V376L probably damaging Het
Tmprss11f T A 5: 86,538,033 K158N probably benign Het
Tnip2 G T 5: 34,503,578 Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 probably null Het
Ttc28 C T 5: 111,271,238 P1398S probably benign Het
Umodl1 T G 17: 30,980,359 I308S possibly damaging Het
Vcan A T 13: 89,691,600 S1942T probably damaging Het
Vmn2r124 T A 17: 18,063,077 N344K probably benign Het
Vmn2r25 C G 6: 123,825,318 C542S probably damaging Het
Wiz T A 17: 32,378,496 probably benign Het
Wrap73 A G 4: 154,155,346 Y343C probably benign Het
Other mutations in Krt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Krt1 APN 15 101848193 missense probably damaging 1.00
IGL01478:Krt1 APN 15 101846286 splice site probably benign
IGL01919:Krt1 APN 15 101846376 missense unknown
IGL01970:Krt1 APN 15 101846864 missense possibly damaging 0.95
IGL02207:Krt1 APN 15 101848616 missense possibly damaging 0.94
IGL02643:Krt1 APN 15 101847044 missense probably benign 0.26
R0445:Krt1 UTSW 15 101847621 missense probably damaging 1.00
R0683:Krt1 UTSW 15 101850466 missense unknown
R1006:Krt1 UTSW 15 101847891 missense possibly damaging 0.96
R1163:Krt1 UTSW 15 101848165 nonsense probably null
R1217:Krt1 UTSW 15 101848981 missense possibly damaging 0.90
R1325:Krt1 UTSW 15 101848206 splice site probably null
R1965:Krt1 UTSW 15 101848992 missense probably benign 0.13
R1966:Krt1 UTSW 15 101848992 missense probably benign 0.13
R2101:Krt1 UTSW 15 101846187 missense unknown
R2302:Krt1 UTSW 15 101846187 missense unknown
R2697:Krt1 UTSW 15 101846929 missense probably damaging 1.00
R3034:Krt1 UTSW 15 101850633 missense unknown
R3079:Krt1 UTSW 15 101846187 missense unknown
R3080:Krt1 UTSW 15 101846187 missense unknown
R3891:Krt1 UTSW 15 101850412 missense unknown
R3892:Krt1 UTSW 15 101850412 missense unknown
R4180:Krt1 UTSW 15 101850378 small deletion probably benign
R4305:Krt1 UTSW 15 101850378 small deletion probably benign
R4334:Krt1 UTSW 15 101850378 small deletion probably benign
R4597:Krt1 UTSW 15 101847628 missense possibly damaging 0.90
R4625:Krt1 UTSW 15 101846187 missense unknown
R4626:Krt1 UTSW 15 101846187 missense unknown
R4628:Krt1 UTSW 15 101846187 missense unknown
R4629:Krt1 UTSW 15 101846187 missense unknown
R4630:Krt1 UTSW 15 101846187 missense unknown
R4631:Krt1 UTSW 15 101846187 missense unknown
R4632:Krt1 UTSW 15 101846187 missense unknown
R4633:Krt1 UTSW 15 101846187 missense unknown
R4893:Krt1 UTSW 15 101850120 missense probably damaging 1.00
R4948:Krt1 UTSW 15 101845941 missense unknown
R5193:Krt1 UTSW 15 101845922 missense unknown
R5448:Krt1 UTSW 15 101849029 nonsense probably null
R5494:Krt1 UTSW 15 101850714 missense unknown
R5567:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5570:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5869:Krt1 UTSW 15 101850131 missense probably damaging 1.00
R6200:Krt1 UTSW 15 101850378 small deletion probably benign
R6224:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6326:Krt1 UTSW 15 101850249 missense probably damaging 1.00
R6517:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6525:Krt1 UTSW 15 101850378 small deletion probably benign
R6918:Krt1 UTSW 15 101850177 missense probably damaging 1.00
R7018:Krt1 UTSW 15 101850378 small deletion probably benign
R7040:Krt1 UTSW 15 101850378 small deletion probably benign
R7110:Krt1 UTSW 15 101850378 small deletion probably benign
R7296:Krt1 UTSW 15 101850629 missense unknown
R7368:Krt1 UTSW 15 101846872 missense probably damaging 1.00
R7549:Krt1 UTSW 15 101850378 small deletion probably benign
R7706:Krt1 UTSW 15 101850378 small deletion probably benign
RF003:Krt1 UTSW 15 101850378 small deletion probably benign
X0067:Krt1 UTSW 15 101847755 critical splice donor site probably null
Z1177:Krt1 UTSW 15 101846016 missense unknown
Z1177:Krt1 UTSW 15 101850535 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCCAGAGGACTTAACGC -3'
(R):5'- AGAGCCTTGTCTAATTTAGGGAG -3'

Sequencing Primer
(F):5'- GAGGACTTAACGCCACCG -3'
(R):5'- ATACCCCTTAAGAATGGGGG -3'
Posted On2016-07-06