Incidental Mutation 'R5179:Gadl1'
ID399398
Institutional Source Beutler Lab
Gene Symbol Gadl1
Ensembl Gene ENSMUSG00000056880
Gene Nameglutamate decarboxylase-like 1
Synonyms
MMRRC Submission 042759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5179 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location115909455-116076176 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 115960380 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 251 (C251*)
Ref Sequence ENSEMBL: ENSMUSP00000113240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069651] [ENSMUST00000119291] [ENSMUST00000121770]
Predicted Effect probably null
Transcript: ENSMUST00000069651
AA Change: C251*
SMART Domains Protein: ENSMUSP00000077694
Gene: ENSMUSG00000056880
AA Change: C251*

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 1.1e-113 PFAM
Pfam:Beta_elim_lyase 137 467 1e-7 PFAM
Pfam:Aminotran_5 167 333 1.6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119291
AA Change: C251*
SMART Domains Protein: ENSMUSP00000112433
Gene: ENSMUSG00000056880
AA Change: C251*

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 3.2e-112 PFAM
Pfam:Beta_elim_lyase 137 446 1.6e-6 PFAM
Pfam:Aminotran_5 184 330 3.3e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121770
AA Change: C251*
SMART Domains Protein: ENSMUSP00000113240
Gene: ENSMUSG00000056880
AA Change: C251*

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 2.8e-112 PFAM
Pfam:Beta_elim_lyase 137 461 6.2e-8 PFAM
Pfam:Aminotran_5 184 330 4.1e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B9d2 C A 7: 25,681,401 H5Q probably damaging Het
Bhlhe40 T C 6: 108,665,208 I371T possibly damaging Het
Bmp8a C T 4: 123,313,301 R389H probably damaging Het
Cc2d2a T A 5: 43,688,221 N326K possibly damaging Het
Ccdc154 A G 17: 25,171,163 N545S probably benign Het
Ccser2 A T 14: 36,879,351 S359T possibly damaging Het
Cd22 T A 7: 30,875,874 T248S possibly damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dnhd1 T C 7: 105,714,552 I4107T probably damaging Het
Egf T A 3: 129,686,287 H488L probably damaging Het
Epb41l4b A G 4: 57,063,181 V503A probably benign Het
Exd2 G T 12: 80,484,344 W105L probably damaging Het
Flrt2 A T 12: 95,780,347 R486S probably benign Het
Ifit2 C A 19: 34,573,576 P172Q probably damaging Het
Incenp G C 19: 9,894,909 Q62E unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrg1 A G 17: 56,120,795 L59P possibly damaging Het
Luc7l3 T C 11: 94,300,053 E145G possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nploc4 T C 11: 120,408,856 D346G probably benign Het
Olfr504 T C 7: 108,565,226 I190V probably benign Het
Olfr734 G A 14: 50,320,536 Q100* probably null Het
Osbpl8 T G 10: 111,272,164 D298E probably benign Het
Pcna-ps2 T C 19: 9,283,527 L50P probably damaging Het
Ptgir C T 7: 16,907,328 P182S probably damaging Het
Rictor A G 15: 6,795,940 Y1653C probably damaging Het
Sgcd T A 11: 46,980,884 E208V probably benign Het
Slc7a8 A T 14: 54,724,832 C448* probably null Het
Sos2 G A 12: 69,650,728 R73* probably null Het
Tecpr2 A G 12: 110,944,693 T1055A possibly damaging Het
Usp47 T C 7: 112,093,432 Y1014H probably damaging Het
Vmn2r6 A T 3: 64,537,990 F682L probably benign Het
Other mutations in Gadl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Gadl1 APN 9 115954839 critical splice donor site probably null
IGL01343:Gadl1 APN 9 116074112 makesense probably null
IGL01693:Gadl1 APN 9 115949585 missense probably damaging 1.00
IGL02106:Gadl1 APN 9 115937157 utr 5 prime probably benign
IGL02740:Gadl1 APN 9 116006561 nonsense probably null
IGL03063:Gadl1 APN 9 115966267 missense probably damaging 1.00
IGL03104:Gadl1 APN 9 116074040 missense possibly damaging 0.93
IGL03127:Gadl1 APN 9 115948664 missense probably damaging 1.00
R0133:Gadl1 UTSW 9 115941343 missense probably benign 0.00
R0285:Gadl1 UTSW 9 116030738 splice site probably benign
R0737:Gadl1 UTSW 9 116073987 missense probably damaging 0.99
R0771:Gadl1 UTSW 9 115944232 missense probably damaging 1.00
R1522:Gadl1 UTSW 9 115944229 missense probably damaging 1.00
R1716:Gadl1 UTSW 9 116006508 nonsense probably null
R2061:Gadl1 UTSW 9 115941380 missense probably damaging 1.00
R2163:Gadl1 UTSW 9 115949558 missense possibly damaging 0.93
R3854:Gadl1 UTSW 9 116006664 nonsense probably null
R3964:Gadl1 UTSW 9 115965608 missense probably damaging 0.98
R4654:Gadl1 UTSW 9 115941340 missense probably damaging 1.00
R4724:Gadl1 UTSW 9 115954617 missense possibly damaging 0.81
R4765:Gadl1 UTSW 9 115966313 missense probably null 0.00
R4956:Gadl1 UTSW 9 116040919 missense probably benign 0.00
R5593:Gadl1 UTSW 9 116006650 missense probably damaging 1.00
R5620:Gadl1 UTSW 9 115937162 start codon destroyed probably benign 0.09
R6048:Gadl1 UTSW 9 116006701 splice site probably null
R6458:Gadl1 UTSW 9 116041002 makesense probably null
R7497:Gadl1 UTSW 9 116074087 missense probably benign 0.00
R7889:Gadl1 UTSW 9 115954815 missense possibly damaging 0.56
Z1088:Gadl1 UTSW 9 115937270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCAGAGGCCACATAGTATG -3'
(R):5'- GTAAGTGCATGCTCATTTCCC -3'

Sequencing Primer
(F):5'- GGCCACATAGTATGGAAATGTCCC -3'
(R):5'- CTCCCAAGTAAGAGGCTTCTAGATTC -3'
Posted On2016-07-06