Incidental Mutation 'R5254:Vmn2r124'
ID 399405
Institutional Source Beutler Lab
Gene Symbol Vmn2r124
Ensembl Gene ENSMUSG00000094396
Gene Name vomeronasal 2, receptor 124
Synonyms Vmn2r-ps113, Gm7196
MMRRC Submission 042825-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.308) question?
Stock # R5254 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 18269746-18294482 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18283339 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 344 (N344K)
Ref Sequence ENSEMBL: ENSMUSP00000135613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176802] [ENSMUST00000231546]
AlphaFold K7N789
Predicted Effect probably benign
Transcript: ENSMUST00000176802
AA Change: N344K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135613
Gene: ENSMUSG00000094396
AA Change: N344K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 84 449 2.2e-37 PFAM
Pfam:NCD3G 510 563 9.3e-21 PFAM
Pfam:7tm_3 596 831 1.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231546
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,911,042 (GRCm39) C296* probably null Het
Adam11 T A 11: 102,665,098 (GRCm39) Y413* probably null Het
Ankhd1 A G 18: 36,789,768 (GRCm39) I907V probably benign Het
Arrdc5 A G 17: 56,604,897 (GRCm39) I130T probably benign Het
Asic5 T A 3: 81,928,294 (GRCm39) I419K probably damaging Het
Atp4a A T 7: 30,414,955 (GRCm39) E248V probably damaging Het
Avil C A 10: 126,847,630 (GRCm39) V154L probably benign Het
Bclaf1 T A 10: 20,199,282 (GRCm39) H226Q possibly damaging Het
Cald1 A G 6: 34,723,351 (GRCm39) probably benign Het
Cd200r4 A C 16: 44,652,453 (GRCm39) D27A possibly damaging Het
Cdsn T A 17: 35,863,099 (GRCm39) M1K probably null Het
Cfap46 T A 7: 139,258,430 (GRCm39) H281L possibly damaging Het
Chaf1a T C 17: 56,369,606 (GRCm39) F533L probably benign Het
Chil4 T A 3: 106,126,768 (GRCm39) I5F probably benign Het
Ctu2 A T 8: 123,203,327 (GRCm39) R48W probably damaging Het
Daam1 A T 12: 71,993,350 (GRCm39) H373L unknown Het
Dcaf10 T A 4: 45,370,415 (GRCm39) Y328N possibly damaging Het
Dst A T 1: 34,217,012 (GRCm39) K1151* probably null Het
Ect2 T C 3: 27,184,219 (GRCm39) D503G probably damaging Het
Epm2a C A 10: 11,333,089 (GRCm39) D307E probably benign Het
Exph5 A T 9: 53,249,230 (GRCm39) D73V probably damaging Het
Fam20b C T 1: 156,533,310 (GRCm39) G102D probably damaging Het
Fat2 T C 11: 55,172,001 (GRCm39) N2904S probably damaging Het
Flt3 T A 5: 147,312,500 (GRCm39) Q147L possibly damaging Het
Fndc11 A G 2: 180,863,956 (GRCm39) T254A possibly damaging Het
Galnt15 C T 14: 31,780,244 (GRCm39) R514* probably null Het
Gbgt1 A G 2: 28,395,220 (GRCm39) D286G probably damaging Het
Ggt1 T A 10: 75,415,032 (GRCm39) probably null Het
Gm26526 A T 7: 39,238,658 (GRCm39) noncoding transcript Het
H2-K2 T C 17: 34,216,436 (GRCm39) T237A probably damaging Het
Igf1r T A 7: 67,857,067 (GRCm39) S1010T probably damaging Het
Il21 T C 3: 37,281,884 (GRCm39) T87A possibly damaging Het
Kmt2b G A 7: 30,268,600 (GRCm39) R2010C probably damaging Het
Kmt2c G A 5: 25,519,592 (GRCm39) P2173S probably benign Het
Krt1 A T 15: 101,754,803 (GRCm39) S512T unknown Het
Krtap16-1 G A 11: 99,876,424 (GRCm39) R327* probably null Het
Lama1 T A 17: 68,063,711 (GRCm39) I745N probably benign Het
Lrrk1 T A 7: 65,956,855 (GRCm39) N372I probably benign Het
Lyst A T 13: 13,857,655 (GRCm39) E2481D probably benign Het
Map2k1 A T 9: 64,095,027 (GRCm39) probably benign Het
Mbip A G 12: 56,384,228 (GRCm39) V215A probably damaging Het
Mdc1 T A 17: 36,158,814 (GRCm39) V398D probably benign Het
Mog T G 17: 37,323,264 (GRCm39) I225L probably benign Het
Mrgprx3-ps T A 7: 46,959,184 (GRCm39) noncoding transcript Het
Muc5b C T 7: 141,418,277 (GRCm39) S3741L probably benign Het
Myo5a A T 9: 75,037,402 (GRCm39) I202F probably damaging Het
Myo5b A T 18: 74,833,677 (GRCm39) I818F possibly damaging Het
Nfia T A 4: 97,902,534 (GRCm39) M262K probably damaging Het
Nisch C T 14: 30,928,524 (GRCm39) probably null Het
Nkd1 A G 8: 89,315,822 (GRCm39) D64G probably damaging Het
Nt5c2 T A 19: 46,881,999 (GRCm39) K284* probably null Het
Or14a259 A T 7: 86,013,398 (GRCm39) V49E possibly damaging Het
Or4k15b C A 14: 50,272,135 (GRCm39) A242S possibly damaging Het
Or4l1 A T 14: 50,166,236 (GRCm39) I255N probably damaging Het
Or52z14 T G 7: 103,252,996 (GRCm39) I45R probably benign Het
Or5an1c A G 19: 12,218,612 (GRCm39) S138P probably damaging Het
Or5j3 A T 2: 86,128,265 (GRCm39) Y35F probably damaging Het
Or8g55 A T 9: 39,784,741 (GRCm39) T57S possibly damaging Het
Or8k24 A T 2: 86,216,484 (GRCm39) S93T possibly damaging Het
Pcdhb17 A T 18: 37,619,878 (GRCm39) D556V probably damaging Het
Pcdhga8 A T 18: 37,859,673 (GRCm39) D243V probably benign Het
Polq A T 16: 36,909,681 (GRCm39) Q2355L probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc5a4a C A 10: 76,018,572 (GRCm39) Y506* probably null Het
Sp110 G C 1: 85,504,923 (GRCm39) probably benign Het
Tarbp1 G A 8: 127,193,895 (GRCm39) H336Y probably damaging Het
Tas2r134 T G 2: 51,517,559 (GRCm39) F13V probably benign Het
Tgfb2 A G 1: 186,436,680 (GRCm39) Y98H probably damaging Het
Tmprss11a C A 5: 86,559,665 (GRCm39) V376L probably damaging Het
Tmprss11f T A 5: 86,685,892 (GRCm39) K158N probably benign Het
Tnip2 G T 5: 34,660,922 (GRCm39) Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 (GRCm39) probably null Het
Ttc28 C T 5: 111,419,104 (GRCm39) P1398S probably benign Het
Umodl1 T G 17: 31,199,333 (GRCm39) I308S possibly damaging Het
Vcan A T 13: 89,839,719 (GRCm39) S1942T probably damaging Het
Vmn2r25 C G 6: 123,802,277 (GRCm39) C542S probably damaging Het
Wiz T A 17: 32,597,470 (GRCm39) probably benign Het
Wrap73 A G 4: 154,239,803 (GRCm39) Y343C probably benign Het
Other mutations in Vmn2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Vmn2r124 APN 17 18,282,932 (GRCm39) missense probably benign 0.04
IGL01356:Vmn2r124 APN 17 18,293,733 (GRCm39) missense probably benign 0.08
IGL01387:Vmn2r124 APN 17 18,283,188 (GRCm39) missense probably damaging 0.98
IGL01413:Vmn2r124 APN 17 18,282,827 (GRCm39) missense probably benign 0.41
IGL01550:Vmn2r124 APN 17 18,283,617 (GRCm39) critical splice donor site probably null
IGL01759:Vmn2r124 APN 17 18,284,330 (GRCm39) missense probably benign 0.00
IGL01762:Vmn2r124 APN 17 18,283,434 (GRCm39) missense possibly damaging 0.51
IGL02132:Vmn2r124 APN 17 18,284,491 (GRCm39) splice site probably benign
IGL02290:Vmn2r124 APN 17 18,293,597 (GRCm39) missense probably benign 0.09
IGL02370:Vmn2r124 APN 17 18,284,453 (GRCm39) missense probably benign 0.14
IGL02527:Vmn2r124 APN 17 18,286,764 (GRCm39) critical splice acceptor site probably null
PIT4280001:Vmn2r124 UTSW 17 18,283,487 (GRCm39) missense probably benign 0.22
PIT4514001:Vmn2r124 UTSW 17 18,293,974 (GRCm39) missense probably benign 0.01
R0362:Vmn2r124 UTSW 17 18,284,486 (GRCm39) critical splice donor site probably null
R0401:Vmn2r124 UTSW 17 18,284,407 (GRCm39) missense probably damaging 0.99
R0513:Vmn2r124 UTSW 17 18,293,991 (GRCm39) missense possibly damaging 0.89
R1139:Vmn2r124 UTSW 17 18,294,052 (GRCm39) missense possibly damaging 0.56
R1513:Vmn2r124 UTSW 17 18,283,535 (GRCm39) missense probably damaging 1.00
R1669:Vmn2r124 UTSW 17 18,283,206 (GRCm39) missense possibly damaging 0.94
R1710:Vmn2r124 UTSW 17 18,282,187 (GRCm39) splice site probably benign
R1852:Vmn2r124 UTSW 17 18,283,436 (GRCm39) missense probably benign
R1860:Vmn2r124 UTSW 17 18,269,759 (GRCm39) missense probably benign 0.11
R1953:Vmn2r124 UTSW 17 18,283,122 (GRCm39) missense probably benign 0.08
R2233:Vmn2r124 UTSW 17 18,269,927 (GRCm39) missense possibly damaging 0.95
R2234:Vmn2r124 UTSW 17 18,269,927 (GRCm39) missense possibly damaging 0.95
R2235:Vmn2r124 UTSW 17 18,269,927 (GRCm39) missense possibly damaging 0.95
R2397:Vmn2r124 UTSW 17 18,269,859 (GRCm39) missense possibly damaging 0.95
R2519:Vmn2r124 UTSW 17 18,294,280 (GRCm39) missense probably damaging 1.00
R3845:Vmn2r124 UTSW 17 18,293,953 (GRCm39) missense possibly damaging 0.90
R3846:Vmn2r124 UTSW 17 18,293,953 (GRCm39) missense possibly damaging 0.90
R4594:Vmn2r124 UTSW 17 18,294,231 (GRCm39) missense probably damaging 1.00
R4612:Vmn2r124 UTSW 17 18,283,284 (GRCm39) missense probably benign 0.12
R4790:Vmn2r124 UTSW 17 18,269,855 (GRCm39) missense probably damaging 1.00
R4809:Vmn2r124 UTSW 17 18,294,007 (GRCm39) missense probably benign 0.00
R5227:Vmn2r124 UTSW 17 18,269,819 (GRCm39) missense possibly damaging 0.95
R5609:Vmn2r124 UTSW 17 18,294,102 (GRCm39) missense probably benign
R6145:Vmn2r124 UTSW 17 18,283,113 (GRCm39) missense probably benign 0.05
R6181:Vmn2r124 UTSW 17 18,294,019 (GRCm39) missense possibly damaging 0.93
R6271:Vmn2r124 UTSW 17 18,283,145 (GRCm39) missense probably benign 0.01
R7297:Vmn2r124 UTSW 17 18,293,835 (GRCm39) missense probably damaging 1.00
R7397:Vmn2r124 UTSW 17 18,282,947 (GRCm39) missense probably damaging 1.00
R7406:Vmn2r124 UTSW 17 18,282,306 (GRCm39) missense unknown
R7699:Vmn2r124 UTSW 17 18,293,985 (GRCm39) missense probably benign 0.00
R7859:Vmn2r124 UTSW 17 18,282,212 (GRCm39) missense probably damaging 1.00
R8121:Vmn2r124 UTSW 17 18,282,433 (GRCm39) missense probably benign
R8138:Vmn2r124 UTSW 17 18,283,610 (GRCm39) missense probably damaging 0.99
R8756:Vmn2r124 UTSW 17 18,294,094 (GRCm39) missense probably benign 0.08
R8796:Vmn2r124 UTSW 17 18,282,933 (GRCm39) missense possibly damaging 0.95
R8841:Vmn2r124 UTSW 17 18,283,299 (GRCm39) missense
R8960:Vmn2r124 UTSW 17 18,283,291 (GRCm39) nonsense probably null
R8970:Vmn2r124 UTSW 17 18,294,439 (GRCm39) missense probably benign
R9128:Vmn2r124 UTSW 17 18,294,439 (GRCm39) missense probably benign
R9566:Vmn2r124 UTSW 17 18,293,581 (GRCm39) missense probably benign 0.14
R9680:Vmn2r124 UTSW 17 18,293,758 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACAGTGATACTCTAGAAGGTC -3'
(R):5'- GCTATGAGCCAGAGCATACAC -3'

Sequencing Primer
(F):5'- ACAGTGATACTCTAGAAGGTCTAATG -3'
(R):5'- CACACCATTGTAAATATTTGTGCTC -3'
Posted On 2016-07-06