Incidental Mutation 'R0455:Atf6'
ID 39941
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms 9130025P16Rik, ESTM49, Atf6alpha
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R0455 (G1)
Quality Score 201
Status Validated
Chromosome 1
Chromosomal Location 170704674-170867771 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 170834923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 256 (V256A)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably benign
Transcript: ENSMUST00000027974
AA Change: V256A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: V256A

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179933
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R2164:Atf6 UTSW 1 170794735 missense probably damaging 1.00
R3782:Atf6 UTSW 1 170794767 nonsense probably null
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R4676:Atf6 UTSW 1 170787410 missense probably damaging 1.00
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841775 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8860:Atf6 UTSW 1 170852966 missense probably null 0.95
R8956:Atf6 UTSW 1 170794007 missense probably damaging 0.98
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9271:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9323:Atf6 UTSW 1 170855113 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAAGACGTGCCTACTTCATGCTTC -3'
(R):5'- TCCCTTACAGAGTTACACACTGACTCC -3'

Sequencing Primer
(F):5'- CCAAATGTGCAATTTTGGCACAC -3'
(R):5'- AGAGTTACACACTGACTCCTTCTC -3'
Posted On 2013-05-23