Incidental Mutation 'R5179:Nploc4'
ID399410
Institutional Source Beutler Lab
Gene Symbol Nploc4
Ensembl Gene ENSMUSG00000039703
Gene NameNPL4 homolog, ubiquitin recognition factor
Synonyms
MMRRC Submission 042759-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5179 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120380370-120437708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120408856 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 346 (D346G)
Ref Sequence ENSEMBL: ENSMUSP00000099306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044271] [ENSMUST00000103017]
Predicted Effect probably benign
Transcript: ENSMUST00000044271
AA Change: D346G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035851
Gene: ENSMUSG00000039703
AA Change: D346G

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 1.1e-36 PFAM
Pfam:zf-NPL4 105 245 2.1e-64 PFAM
Pfam:NPL4 248 557 4.8e-129 PFAM
ZnF_RBZ 582 606 8.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103017
AA Change: D346G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099306
Gene: ENSMUSG00000039703
AA Change: D346G

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 7e-38 PFAM
Pfam:zf-NPL4 104 246 1.1e-61 PFAM
Pfam:NPL4 248 455 1.8e-87 PFAM
Pfam:NPL4 451 525 3e-15 PFAM
ZnF_RBZ 550 574 8.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136095
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B9d2 C A 7: 25,681,401 H5Q probably damaging Het
Bhlhe40 T C 6: 108,665,208 I371T possibly damaging Het
Bmp8a C T 4: 123,313,301 R389H probably damaging Het
Cc2d2a T A 5: 43,688,221 N326K possibly damaging Het
Ccdc154 A G 17: 25,171,163 N545S probably benign Het
Ccser2 A T 14: 36,879,351 S359T possibly damaging Het
Cd22 T A 7: 30,875,874 T248S possibly damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dnhd1 T C 7: 105,714,552 I4107T probably damaging Het
Egf T A 3: 129,686,287 H488L probably damaging Het
Epb41l4b A G 4: 57,063,181 V503A probably benign Het
Exd2 G T 12: 80,484,344 W105L probably damaging Het
Flrt2 A T 12: 95,780,347 R486S probably benign Het
Gadl1 C A 9: 115,960,380 C251* probably null Het
Ifit2 C A 19: 34,573,576 P172Q probably damaging Het
Incenp G C 19: 9,894,909 Q62E unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrg1 A G 17: 56,120,795 L59P possibly damaging Het
Luc7l3 T C 11: 94,300,053 E145G possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Olfr504 T C 7: 108,565,226 I190V probably benign Het
Olfr734 G A 14: 50,320,536 Q100* probably null Het
Osbpl8 T G 10: 111,272,164 D298E probably benign Het
Pcna-ps2 T C 19: 9,283,527 L50P probably damaging Het
Ptgir C T 7: 16,907,328 P182S probably damaging Het
Rictor A G 15: 6,795,940 Y1653C probably damaging Het
Sgcd T A 11: 46,980,884 E208V probably benign Het
Slc7a8 A T 14: 54,724,832 C448* probably null Het
Sos2 G A 12: 69,650,728 R73* probably null Het
Tecpr2 A G 12: 110,944,693 T1055A possibly damaging Het
Usp47 T C 7: 112,093,432 Y1014H probably damaging Het
Vmn2r6 A T 3: 64,537,990 F682L probably benign Het
Other mutations in Nploc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Nploc4 APN 11 120389372 missense probably benign 0.06
IGL03373:Nploc4 APN 11 120409629 nonsense probably null
P0041:Nploc4 UTSW 11 120418331 missense probably damaging 1.00
R0200:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R0608:Nploc4 UTSW 11 120413681 missense probably damaging 1.00
R1401:Nploc4 UTSW 11 120383289 splice site probably benign
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1465:Nploc4 UTSW 11 120408781 missense probably damaging 0.98
R1722:Nploc4 UTSW 11 120382569 missense probably benign 0.02
R1919:Nploc4 UTSW 11 120404229 missense probably damaging 1.00
R2436:Nploc4 UTSW 11 120418317 missense possibly damaging 0.79
R4603:Nploc4 UTSW 11 120385787 missense probably benign 0.00
R4771:Nploc4 UTSW 11 120421434 missense possibly damaging 0.47
R5361:Nploc4 UTSW 11 120384563 missense probably damaging 1.00
R5414:Nploc4 UTSW 11 120413643 missense probably damaging 0.99
R5567:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R5570:Nploc4 UTSW 11 120384614 missense probably benign 0.00
R6259:Nploc4 UTSW 11 120385865 missense probably benign 0.01
R6547:Nploc4 UTSW 11 120428522 critical splice donor site probably null
R6683:Nploc4 UTSW 11 120383330 missense probably damaging 0.98
R7134:Nploc4 UTSW 11 120385788 missense probably benign 0.02
R7256:Nploc4 UTSW 11 120428550 missense probably benign
R7284:Nploc4 UTSW 11 120416370 missense possibly damaging 0.89
R7386:Nploc4 UTSW 11 120408881 missense probably benign 0.17
R8130:Nploc4 UTSW 11 120389414 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCTTATTGTAACCAAGGTAAAGATGGG -3'
(R):5'- ACACGAGTCCCTGATAGCTAGG -3'

Sequencing Primer
(F):5'- TAAAGATGGGAAGCTGCTGC -3'
(R):5'- TGTGCACACATGTGTCACAG -3'
Posted On2016-07-06