Incidental Mutation 'R5254:Mdc1'
ID399413
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 042825-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5254 (G1)
Quality Score217
Status Validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35847922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 398 (V398D)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: V398D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: V398D

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Meta Mutation Damage Score 0.1138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,458,398 C296* probably null Het
Adam11 T A 11: 102,774,272 Y413* probably null Het
Ankhd1 A G 18: 36,656,715 I907V probably benign Het
Arrdc5 A G 17: 56,297,897 I130T probably benign Het
Asic5 T A 3: 82,020,987 I419K probably damaging Het
Atp4a A T 7: 30,715,530 E248V probably damaging Het
Avil C A 10: 127,011,761 V154L probably benign Het
Bclaf1 T A 10: 20,323,536 H226Q possibly damaging Het
Cald1 A G 6: 34,746,416 probably benign Het
Cd200r4 A C 16: 44,832,090 D27A possibly damaging Het
Cdsn T A 17: 35,552,202 M1K probably null Het
Cfap46 T A 7: 139,678,514 H281L possibly damaging Het
Chaf1a T C 17: 56,062,606 F533L probably benign Het
Chil4 T A 3: 106,219,452 I5F probably benign Het
Ctu2 A T 8: 122,476,588 R48W probably damaging Het
Daam1 A T 12: 71,946,576 H373L unknown Het
Dcaf10 T A 4: 45,370,415 Y328N possibly damaging Het
Dst A T 1: 34,177,931 K1151* probably null Het
Ect2 T C 3: 27,130,070 D503G probably damaging Het
Epm2a C A 10: 11,457,345 D307E probably benign Het
Exph5 A T 9: 53,337,930 D73V probably damaging Het
Fam20b C T 1: 156,705,740 G102D probably damaging Het
Fat2 T C 11: 55,281,175 N2904S probably damaging Het
Flt3 T A 5: 147,375,690 Q147L possibly damaging Het
Fndc11 A G 2: 181,222,163 T254A possibly damaging Het
Galnt15 C T 14: 32,058,287 R514* probably null Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Ggt1 T A 10: 75,579,198 probably null Het
Gm26526 A T 7: 39,589,234 noncoding transcript Het
H2-K1 T C 17: 33,997,462 T237A probably damaging Het
Igf1r T A 7: 68,207,319 S1010T probably damaging Het
Il21 T C 3: 37,227,735 T87A possibly damaging Het
Kmt2b G A 7: 30,569,175 R2010C probably damaging Het
Kmt2c G A 5: 25,314,594 P2173S probably benign Het
Krt1 A T 15: 101,846,368 S512T unknown Het
Krtap16-1 G A 11: 99,985,598 R327* probably null Het
Lama1 T A 17: 67,756,716 I745N probably benign Het
Lrrk1 T A 7: 66,307,107 N372I probably benign Het
Lyst A T 13: 13,683,070 E2481D probably benign Het
Map2k1 A T 9: 64,187,745 probably benign Het
Mbip A G 12: 56,337,443 V215A probably damaging Het
Mog T G 17: 37,012,372 I225L probably benign Het
Mrgprx3-ps T A 7: 47,309,436 noncoding transcript Het
Muc5b C T 7: 141,864,540 S3741L probably benign Het
Myo5a A T 9: 75,130,120 I202F probably damaging Het
Myo5b A T 18: 74,700,606 I818F possibly damaging Het
Nfia T A 4: 98,014,297 M262K probably damaging Het
Nisch C T 14: 31,206,567 probably null Het
Nkd1 A G 8: 88,589,194 D64G probably damaging Het
Nt5c2 T A 19: 46,893,560 K284* probably null Het
Olfr1052 A T 2: 86,297,921 Y35F probably damaging Het
Olfr1058 A T 2: 86,386,140 S93T possibly damaging Het
Olfr262 A G 19: 12,241,248 S138P probably damaging Het
Olfr305 A T 7: 86,364,190 V49E possibly damaging Het
Olfr619 T G 7: 103,603,789 I45R probably benign Het
Olfr723 A T 14: 49,928,779 I255N probably damaging Het
Olfr725 C A 14: 50,034,678 A242S possibly damaging Het
Olfr972 A T 9: 39,873,445 T57S possibly damaging Het
Pcdhb17 A T 18: 37,486,825 D556V probably damaging Het
Pcdhga8 A T 18: 37,726,620 D243V probably benign Het
Polq A T 16: 37,089,319 Q2355L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc5a4a C A 10: 76,182,738 Y506* probably null Het
Sp110 G C 1: 85,577,202 probably benign Het
Tarbp1 G A 8: 126,467,156 H336Y probably damaging Het
Tas2r134 T G 2: 51,627,547 F13V probably benign Het
Tgfb2 A G 1: 186,704,483 Y98H probably damaging Het
Tmprss11a C A 5: 86,411,806 V376L probably damaging Het
Tmprss11f T A 5: 86,538,033 K158N probably benign Het
Tnip2 G T 5: 34,503,578 Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 probably null Het
Ttc28 C T 5: 111,271,238 P1398S probably benign Het
Umodl1 T G 17: 30,980,359 I308S possibly damaging Het
Vcan A T 13: 89,691,600 S1942T probably damaging Het
Vmn2r124 T A 17: 18,063,077 N344K probably benign Het
Vmn2r25 C G 6: 123,825,318 C542S probably damaging Het
Wiz T A 17: 32,378,496 probably benign Het
Wrap73 A G 4: 154,155,346 Y343C probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAGATCCTGAAGCACCTG -3'
(R):5'- CTGGCTGTGTGACAGTAAGAGC -3'

Sequencing Primer
(F):5'- ATCCTGAAGCACCTGGTGTGG -3'
(R):5'- CTGTGTGACAGTAAGAGCCTCATC -3'
Posted On2016-07-06