Incidental Mutation 'R5179:Exd2'
ID399414
Institutional Source Beutler Lab
Gene Symbol Exd2
Ensembl Gene ENSMUSG00000032705
Gene Nameexonuclease 3'-5' domain containing 2
Synonyms4930539P14Rik, Exdl2
MMRRC Submission 042759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5179 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80463095-80500227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80484344 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 105 (W105L)
Ref Sequence ENSEMBL: ENSMUSP00000151717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038185] [ENSMUST00000219039] [ENSMUST00000219272]
Predicted Effect probably damaging
Transcript: ENSMUST00000038185
AA Change: W259L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043049
Gene: ENSMUSG00000032705
AA Change: W259L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 40 72 N/A INTRINSIC
35EXOc 105 291 3.8e-10 SMART
Blast:HNHc 438 492 1e-6 BLAST
low complexity region 517 532 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000219039
AA Change: W3L
Predicted Effect probably damaging
Transcript: ENSMUST00000219272
AA Change: W105L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219477
Meta Mutation Damage Score 0.3854 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B9d2 C A 7: 25,681,401 H5Q probably damaging Het
Bhlhe40 T C 6: 108,665,208 I371T possibly damaging Het
Bmp8a C T 4: 123,313,301 R389H probably damaging Het
Cc2d2a T A 5: 43,688,221 N326K possibly damaging Het
Ccdc154 A G 17: 25,171,163 N545S probably benign Het
Ccser2 A T 14: 36,879,351 S359T possibly damaging Het
Cd22 T A 7: 30,875,874 T248S possibly damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dnhd1 T C 7: 105,714,552 I4107T probably damaging Het
Egf T A 3: 129,686,287 H488L probably damaging Het
Epb41l4b A G 4: 57,063,181 V503A probably benign Het
Flrt2 A T 12: 95,780,347 R486S probably benign Het
Gadl1 C A 9: 115,960,380 C251* probably null Het
Ifit2 C A 19: 34,573,576 P172Q probably damaging Het
Incenp G C 19: 9,894,909 Q62E unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrg1 A G 17: 56,120,795 L59P possibly damaging Het
Luc7l3 T C 11: 94,300,053 E145G possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nploc4 T C 11: 120,408,856 D346G probably benign Het
Olfr504 T C 7: 108,565,226 I190V probably benign Het
Olfr734 G A 14: 50,320,536 Q100* probably null Het
Osbpl8 T G 10: 111,272,164 D298E probably benign Het
Pcna-ps2 T C 19: 9,283,527 L50P probably damaging Het
Ptgir C T 7: 16,907,328 P182S probably damaging Het
Rictor A G 15: 6,795,940 Y1653C probably damaging Het
Sgcd T A 11: 46,980,884 E208V probably benign Het
Slc7a8 A T 14: 54,724,832 C448* probably null Het
Sos2 G A 12: 69,650,728 R73* probably null Het
Tecpr2 A G 12: 110,944,693 T1055A possibly damaging Het
Usp47 T C 7: 112,093,432 Y1014H probably damaging Het
Vmn2r6 A T 3: 64,537,990 F682L probably benign Het
Other mutations in Exd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Exd2 APN 12 80476166 missense probably damaging 1.00
IGL00546:Exd2 APN 12 80480547 missense probably benign 0.05
IGL02964:Exd2 APN 12 80480528 missense probably damaging 0.99
IGL03036:Exd2 APN 12 80489411 missense probably damaging 1.00
R0304:Exd2 UTSW 12 80491240 unclassified probably benign
R0436:Exd2 UTSW 12 80490770 splice site probably benign
R1290:Exd2 UTSW 12 80484326 missense probably benign 0.00
R1772:Exd2 UTSW 12 80489479 missense probably benign 0.00
R2102:Exd2 UTSW 12 80480603 missense possibly damaging 0.78
R2104:Exd2 UTSW 12 80496801 missense probably benign 0.01
R2408:Exd2 UTSW 12 80484241 splice site probably benign
R3693:Exd2 UTSW 12 80480693 missense probably damaging 1.00
R4748:Exd2 UTSW 12 80480576 missense probably damaging 1.00
R4773:Exd2 UTSW 12 80475818 missense possibly damaging 0.46
R5022:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5057:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5377:Exd2 UTSW 12 80489448 missense probably damaging 1.00
R7246:Exd2 UTSW 12 80480535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAATCTGATAGCAAATCACC -3'
(R):5'- AATGGTCACCTCTGGGTAGAAG -3'

Sequencing Primer
(F):5'- GCAAATCACCATTTTCTTTGATGTC -3'
(R):5'- CAGAGAACTGCTTACTGTTTCTTATG -3'
Posted On2016-07-06