Incidental Mutation 'R5254:Mog'
ID399415
Institutional Source Beutler Lab
Gene Symbol Mog
Ensembl Gene ENSMUSG00000076439
Gene Namemyelin oligodendrocyte glycoprotein
SynonymsB230317G11Rik
MMRRC Submission 042825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5254 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37010743-37023398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37012372 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 225 (I225L)
Ref Sequence ENSEMBL: ENSMUSP00000099726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069250] [ENSMUST00000089968] [ENSMUST00000102665] [ENSMUST00000167275] [ENSMUST00000172527] [ENSMUST00000172540] [ENSMUST00000172580] [ENSMUST00000173588] [ENSMUST00000174524] [ENSMUST00000174672]
Predicted Effect probably benign
Transcript: ENSMUST00000069250
SMART Domains Protein: ENSMUSP00000065811
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 75 3.9e-24 SMART
ZnF_C2H2 140 162 1.8e-5 SMART
ZnF_C2H2 168 190 9.1e-6 SMART
low complexity region 195 207 N/A INTRINSIC
ZnF_C2H2 264 286 4.2e-4 SMART
ZnF_C2H2 313 333 9.2e-2 SMART
low complexity region 377 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089968
SMART Domains Protein: ENSMUSP00000087414
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 12 72 9.05e-22 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
ZnF_C2H2 165 187 2.09e-3 SMART
low complexity region 192 204 N/A INTRINSIC
ZnF_C2H2 261 283 9.44e-2 SMART
ZnF_C2H2 310 330 2.17e1 SMART
low complexity region 374 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102665
AA Change: I225L

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099726
Gene: ENSMUSG00000076439
AA Change: I225L

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
IGv 48 129 2.28e-16 SMART
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158194
Predicted Effect probably benign
Transcript: ENSMUST00000167275
SMART Domains Protein: ENSMUSP00000129489
Gene: ENSMUSG00000076439

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
IGv 48 129 2.28e-16 SMART
transmembrane domain 156 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172527
SMART Domains Protein: ENSMUSP00000134116
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 62 1.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172540
SMART Domains Protein: ENSMUSP00000134024
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 12 72 9.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172580
SMART Domains Protein: ENSMUSP00000133894
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 12 72 9.05e-22 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173588
SMART Domains Protein: ENSMUSP00000135655
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
Blast:KRAB 1 32 3e-14 BLAST
ZnF_C2H2 97 119 4.17e-3 SMART
ZnF_C2H2 125 145 1.36e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174524
SMART Domains Protein: ENSMUSP00000134418
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 75 3.8e-24 SMART
ZnF_C2H2 140 162 1.8e-5 SMART
ZnF_C2H2 168 190 8.9e-6 SMART
low complexity region 195 207 N/A INTRINSIC
ZnF_C2H2 264 286 4.1e-4 SMART
ZnF_C2H2 313 333 9e-2 SMART
low complexity region 377 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174672
SMART Domains Protein: ENSMUSP00000133821
Gene: ENSMUSG00000036036

DomainStartEndE-ValueType
KRAB 15 75 3.8e-24 SMART
ZnF_C2H2 140 162 1.8e-5 SMART
ZnF_C2H2 168 190 8.9e-6 SMART
low complexity region 195 207 N/A INTRINSIC
ZnF_C2H2 264 286 4.1e-4 SMART
ZnF_C2H2 313 333 9e-2 SMART
low complexity region 377 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: While one line of homozygous mutant mice showed resistance to experimental autoimmune encephalomyelitis (EAE), another showed increased susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,458,398 C296* probably null Het
Adam11 T A 11: 102,774,272 Y413* probably null Het
Ankhd1 A G 18: 36,656,715 I907V probably benign Het
Arrdc5 A G 17: 56,297,897 I130T probably benign Het
Asic5 T A 3: 82,020,987 I419K probably damaging Het
Atp4a A T 7: 30,715,530 E248V probably damaging Het
Avil C A 10: 127,011,761 V154L probably benign Het
Bclaf1 T A 10: 20,323,536 H226Q possibly damaging Het
Cald1 A G 6: 34,746,416 probably benign Het
Cd200r4 A C 16: 44,832,090 D27A possibly damaging Het
Cdsn T A 17: 35,552,202 M1K probably null Het
Cfap46 T A 7: 139,678,514 H281L possibly damaging Het
Chaf1a T C 17: 56,062,606 F533L probably benign Het
Chil4 T A 3: 106,219,452 I5F probably benign Het
Ctu2 A T 8: 122,476,588 R48W probably damaging Het
Daam1 A T 12: 71,946,576 H373L unknown Het
Dcaf10 T A 4: 45,370,415 Y328N possibly damaging Het
Dst A T 1: 34,177,931 K1151* probably null Het
Ect2 T C 3: 27,130,070 D503G probably damaging Het
Epm2a C A 10: 11,457,345 D307E probably benign Het
Exph5 A T 9: 53,337,930 D73V probably damaging Het
Fam20b C T 1: 156,705,740 G102D probably damaging Het
Fat2 T C 11: 55,281,175 N2904S probably damaging Het
Flt3 T A 5: 147,375,690 Q147L possibly damaging Het
Fndc11 A G 2: 181,222,163 T254A possibly damaging Het
Galnt15 C T 14: 32,058,287 R514* probably null Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Ggt1 T A 10: 75,579,198 probably null Het
Gm26526 A T 7: 39,589,234 noncoding transcript Het
H2-K1 T C 17: 33,997,462 T237A probably damaging Het
Igf1r T A 7: 68,207,319 S1010T probably damaging Het
Il21 T C 3: 37,227,735 T87A possibly damaging Het
Kmt2b G A 7: 30,569,175 R2010C probably damaging Het
Kmt2c G A 5: 25,314,594 P2173S probably benign Het
Krt1 A T 15: 101,846,368 S512T unknown Het
Krtap16-1 G A 11: 99,985,598 R327* probably null Het
Lama1 T A 17: 67,756,716 I745N probably benign Het
Lrrk1 T A 7: 66,307,107 N372I probably benign Het
Lyst A T 13: 13,683,070 E2481D probably benign Het
Map2k1 A T 9: 64,187,745 probably benign Het
Mbip A G 12: 56,337,443 V215A probably damaging Het
Mdc1 T A 17: 35,847,922 V398D probably benign Het
Mrgprx3-ps T A 7: 47,309,436 noncoding transcript Het
Muc5b C T 7: 141,864,540 S3741L probably benign Het
Myo5a A T 9: 75,130,120 I202F probably damaging Het
Myo5b A T 18: 74,700,606 I818F possibly damaging Het
Nfia T A 4: 98,014,297 M262K probably damaging Het
Nisch C T 14: 31,206,567 probably null Het
Nkd1 A G 8: 88,589,194 D64G probably damaging Het
Nt5c2 T A 19: 46,893,560 K284* probably null Het
Olfr1052 A T 2: 86,297,921 Y35F probably damaging Het
Olfr1058 A T 2: 86,386,140 S93T possibly damaging Het
Olfr262 A G 19: 12,241,248 S138P probably damaging Het
Olfr305 A T 7: 86,364,190 V49E possibly damaging Het
Olfr619 T G 7: 103,603,789 I45R probably benign Het
Olfr723 A T 14: 49,928,779 I255N probably damaging Het
Olfr725 C A 14: 50,034,678 A242S possibly damaging Het
Olfr972 A T 9: 39,873,445 T57S possibly damaging Het
Pcdhb17 A T 18: 37,486,825 D556V probably damaging Het
Pcdhga8 A T 18: 37,726,620 D243V probably benign Het
Polq A T 16: 37,089,319 Q2355L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc5a4a C A 10: 76,182,738 Y506* probably null Het
Sp110 G C 1: 85,577,202 probably benign Het
Tarbp1 G A 8: 126,467,156 H336Y probably damaging Het
Tas2r134 T G 2: 51,627,547 F13V probably benign Het
Tgfb2 A G 1: 186,704,483 Y98H probably damaging Het
Tmprss11a C A 5: 86,411,806 V376L probably damaging Het
Tmprss11f T A 5: 86,538,033 K158N probably benign Het
Tnip2 G T 5: 34,503,578 Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 probably null Het
Ttc28 C T 5: 111,271,238 P1398S probably benign Het
Umodl1 T G 17: 30,980,359 I308S possibly damaging Het
Vcan A T 13: 89,691,600 S1942T probably damaging Het
Vmn2r124 T A 17: 18,063,077 N344K probably benign Het
Vmn2r25 C G 6: 123,825,318 C542S probably damaging Het
Wiz T A 17: 32,378,496 probably benign Het
Wrap73 A G 4: 154,155,346 Y343C probably benign Het
Other mutations in Mog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Mog APN 17 37017485 splice site probably null
IGL02991:Mog UTSW 17 37023199 start codon destroyed probably null
R0200:Mog UTSW 17 37012419 missense probably damaging 0.97
R0972:Mog UTSW 17 37017532 missense probably benign 0.14
R1565:Mog UTSW 17 37017582 missense possibly damaging 0.73
R3623:Mog UTSW 17 37012446 missense possibly damaging 0.66
R3624:Mog UTSW 17 37012446 missense possibly damaging 0.66
R4079:Mog UTSW 17 37012410 missense probably damaging 1.00
R4772:Mog UTSW 17 37023157 missense unknown
R4944:Mog UTSW 17 37020541 missense probably damaging 0.99
R4991:Mog UTSW 17 37017489 splice site probably null
R5963:Mog UTSW 17 37012348 nonsense probably null
R7257:Mog UTSW 17 37023127 missense unknown
R7498:Mog UTSW 17 37012092 splice site probably null
Predicted Primers PCR Primer
(F):5'- TACATCTCATTAAGTGGTTCTCCG -3'
(R):5'- GGGTCAATGCATGGCTGAAC -3'

Sequencing Primer
(F):5'- AAGTGGTTCTCCGTTTTCCTATG -3'
(R):5'- GCCATGTTCACGGACTCTACAG -3'
Posted On2016-07-06