Incidental Mutation 'R5179:Olfr734'
ID399422
Institutional Source Beutler Lab
Gene Symbol Olfr734
Ensembl Gene ENSMUSG00000045306
Gene Nameolfactory receptor 734
SynonymsMOR242-1, GA_x6K02T2PMLR-6013665-6012724
MMRRC Submission 042759-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R5179 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50316506-50326761 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 50320536 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 100 (Q100*)
Ref Sequence ENSEMBL: ENSMUSP00000150732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050928] [ENSMUST00000217152]
Predicted Effect probably null
Transcript: ENSMUST00000050928
AA Change: Q100*
SMART Domains Protein: ENSMUSP00000057376
Gene: ENSMUSG00000045306
AA Change: Q100*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-39 PFAM
Pfam:7tm_1 41 302 4.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216732
Predicted Effect probably null
Transcript: ENSMUST00000217152
AA Change: Q100*
Meta Mutation Damage Score 0.9666 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B9d2 C A 7: 25,681,401 H5Q probably damaging Het
Bhlhe40 T C 6: 108,665,208 I371T possibly damaging Het
Bmp8a C T 4: 123,313,301 R389H probably damaging Het
Cc2d2a T A 5: 43,688,221 N326K possibly damaging Het
Ccdc154 A G 17: 25,171,163 N545S probably benign Het
Ccser2 A T 14: 36,879,351 S359T possibly damaging Het
Cd22 T A 7: 30,875,874 T248S possibly damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dnhd1 T C 7: 105,714,552 I4107T probably damaging Het
Egf T A 3: 129,686,287 H488L probably damaging Het
Epb41l4b A G 4: 57,063,181 V503A probably benign Het
Exd2 G T 12: 80,484,344 W105L probably damaging Het
Flrt2 A T 12: 95,780,347 R486S probably benign Het
Gadl1 C A 9: 115,960,380 C251* probably null Het
Ifit2 C A 19: 34,573,576 P172Q probably damaging Het
Incenp G C 19: 9,894,909 Q62E unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrg1 A G 17: 56,120,795 L59P possibly damaging Het
Luc7l3 T C 11: 94,300,053 E145G possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nploc4 T C 11: 120,408,856 D346G probably benign Het
Olfr504 T C 7: 108,565,226 I190V probably benign Het
Osbpl8 T G 10: 111,272,164 D298E probably benign Het
Pcna-ps2 T C 19: 9,283,527 L50P probably damaging Het
Ptgir C T 7: 16,907,328 P182S probably damaging Het
Rictor A G 15: 6,795,940 Y1653C probably damaging Het
Sgcd T A 11: 46,980,884 E208V probably benign Het
Slc7a8 A T 14: 54,724,832 C448* probably null Het
Sos2 G A 12: 69,650,728 R73* probably null Het
Tecpr2 A G 12: 110,944,693 T1055A possibly damaging Het
Usp47 T C 7: 112,093,432 Y1014H probably damaging Het
Vmn2r6 A T 3: 64,537,990 F682L probably benign Het
Other mutations in Olfr734
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr734 APN 14 50320275 missense probably damaging 0.96
IGL01285:Olfr734 APN 14 50320256 missense possibly damaging 0.88
IGL02106:Olfr734 APN 14 50320160 missense probably damaging 1.00
IGL02313:Olfr734 APN 14 50320016 missense probably damaging 0.99
IGL03125:Olfr734 APN 14 50320692 missense probably benign 0.01
R0276:Olfr734 UTSW 14 50320179 missense probably benign 0.23
R0547:Olfr734 UTSW 14 50320118 missense probably benign 0.06
R0567:Olfr734 UTSW 14 50320658 missense probably damaging 0.99
R0927:Olfr734 UTSW 14 50320729 nonsense probably null
R1506:Olfr734 UTSW 14 50320484 missense probably benign 0.00
R4032:Olfr734 UTSW 14 50320310 missense possibly damaging 0.91
R5401:Olfr734 UTSW 14 50320109 missense probably damaging 1.00
R6240:Olfr734 UTSW 14 50320586 missense probably benign 0.00
R7752:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R7901:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R7984:Olfr734 UTSW 14 50320116 missense probably damaging 1.00
R8034:Olfr734 UTSW 14 50320566 missense probably damaging 1.00
X0064:Olfr734 UTSW 14 50320054 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTCTAGTTCATTGGGCCC -3'
(R):5'- ATCCTTATTATCTGCACAATCAGGC -3'

Sequencing Primer
(F):5'- GTTCATTGGGCCCACAAAATG -3'
(R):5'- ATCAGGCTTGATTCCCATTTGAG -3'
Posted On2016-07-06