Incidental Mutation 'R5254:Pcdhb17'
ID399425
Institutional Source Beutler Lab
Gene Symbol Pcdhb17
Ensembl Gene ENSMUSG00000046387
Gene Nameprotocadherin beta 17
SynonymsPcdhbQ, Pcdhb16
MMRRC Submission 042825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5254 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37484795-37489454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37486825 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 556 (D556V)
Ref Sequence ENSEMBL: ENSMUSP00000055072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053856
AA Change: D556V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387
AA Change: D556V

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,458,398 C296* probably null Het
Adam11 T A 11: 102,774,272 Y413* probably null Het
Ankhd1 A G 18: 36,656,715 I907V probably benign Het
Arrdc5 A G 17: 56,297,897 I130T probably benign Het
Asic5 T A 3: 82,020,987 I419K probably damaging Het
Atp4a A T 7: 30,715,530 E248V probably damaging Het
Avil C A 10: 127,011,761 V154L probably benign Het
Bclaf1 T A 10: 20,323,536 H226Q possibly damaging Het
Cald1 A G 6: 34,746,416 probably benign Het
Cd200r4 A C 16: 44,832,090 D27A possibly damaging Het
Cdsn T A 17: 35,552,202 M1K probably null Het
Cfap46 T A 7: 139,678,514 H281L possibly damaging Het
Chaf1a T C 17: 56,062,606 F533L probably benign Het
Chil4 T A 3: 106,219,452 I5F probably benign Het
Ctu2 A T 8: 122,476,588 R48W probably damaging Het
Daam1 A T 12: 71,946,576 H373L unknown Het
Dcaf10 T A 4: 45,370,415 Y328N possibly damaging Het
Dst A T 1: 34,177,931 K1151* probably null Het
Ect2 T C 3: 27,130,070 D503G probably damaging Het
Epm2a C A 10: 11,457,345 D307E probably benign Het
Exph5 A T 9: 53,337,930 D73V probably damaging Het
Fam20b C T 1: 156,705,740 G102D probably damaging Het
Fat2 T C 11: 55,281,175 N2904S probably damaging Het
Flt3 T A 5: 147,375,690 Q147L possibly damaging Het
Fndc11 A G 2: 181,222,163 T254A possibly damaging Het
Galnt15 C T 14: 32,058,287 R514* probably null Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Ggt1 T A 10: 75,579,198 probably null Het
Gm26526 A T 7: 39,589,234 noncoding transcript Het
H2-K1 T C 17: 33,997,462 T237A probably damaging Het
Igf1r T A 7: 68,207,319 S1010T probably damaging Het
Il21 T C 3: 37,227,735 T87A possibly damaging Het
Kmt2b G A 7: 30,569,175 R2010C probably damaging Het
Kmt2c G A 5: 25,314,594 P2173S probably benign Het
Krt1 A T 15: 101,846,368 S512T unknown Het
Krtap16-1 G A 11: 99,985,598 R327* probably null Het
Lama1 T A 17: 67,756,716 I745N probably benign Het
Lrrk1 T A 7: 66,307,107 N372I probably benign Het
Lyst A T 13: 13,683,070 E2481D probably benign Het
Map2k1 A T 9: 64,187,745 probably benign Het
Mbip A G 12: 56,337,443 V215A probably damaging Het
Mdc1 T A 17: 35,847,922 V398D probably benign Het
Mog T G 17: 37,012,372 I225L probably benign Het
Mrgprx3-ps T A 7: 47,309,436 noncoding transcript Het
Muc5b C T 7: 141,864,540 S3741L probably benign Het
Myo5a A T 9: 75,130,120 I202F probably damaging Het
Myo5b A T 18: 74,700,606 I818F possibly damaging Het
Nfia T A 4: 98,014,297 M262K probably damaging Het
Nisch C T 14: 31,206,567 probably null Het
Nkd1 A G 8: 88,589,194 D64G probably damaging Het
Nt5c2 T A 19: 46,893,560 K284* probably null Het
Olfr1052 A T 2: 86,297,921 Y35F probably damaging Het
Olfr1058 A T 2: 86,386,140 S93T possibly damaging Het
Olfr262 A G 19: 12,241,248 S138P probably damaging Het
Olfr305 A T 7: 86,364,190 V49E possibly damaging Het
Olfr619 T G 7: 103,603,789 I45R probably benign Het
Olfr723 A T 14: 49,928,779 I255N probably damaging Het
Olfr725 C A 14: 50,034,678 A242S possibly damaging Het
Olfr972 A T 9: 39,873,445 T57S possibly damaging Het
Pcdhga8 A T 18: 37,726,620 D243V probably benign Het
Polq A T 16: 37,089,319 Q2355L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc5a4a C A 10: 76,182,738 Y506* probably null Het
Sp110 G C 1: 85,577,202 probably benign Het
Tarbp1 G A 8: 126,467,156 H336Y probably damaging Het
Tas2r134 T G 2: 51,627,547 F13V probably benign Het
Tgfb2 A G 1: 186,704,483 Y98H probably damaging Het
Tmprss11a C A 5: 86,411,806 V376L probably damaging Het
Tmprss11f T A 5: 86,538,033 K158N probably benign Het
Tnip2 G T 5: 34,503,578 Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 probably null Het
Ttc28 C T 5: 111,271,238 P1398S probably benign Het
Umodl1 T G 17: 30,980,359 I308S possibly damaging Het
Vcan A T 13: 89,691,600 S1942T probably damaging Het
Vmn2r124 T A 17: 18,063,077 N344K probably benign Het
Vmn2r25 C G 6: 123,825,318 C542S probably damaging Het
Wiz T A 17: 32,378,496 probably benign Het
Wrap73 A G 4: 154,155,346 Y343C probably benign Het
Other mutations in Pcdhb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Pcdhb17 APN 18 37486006 unclassified probably null
IGL01367:Pcdhb17 APN 18 37487495 missense probably benign 0.01
IGL01923:Pcdhb17 APN 18 37486737 missense probably benign 0.43
IGL02060:Pcdhb17 APN 18 37486416 missense probably damaging 1.00
IGL02494:Pcdhb17 APN 18 37485294 missense possibly damaging 0.73
IGL02654:Pcdhb17 APN 18 37486561 missense probably benign 0.03
IGL03168:Pcdhb17 APN 18 37485772 missense probably benign 0.15
doughnut UTSW 18 37486936 missense probably damaging 1.00
miniscule UTSW 18 37485667 missense probably damaging 1.00
PIT4434001:Pcdhb17 UTSW 18 37485651 missense probably damaging 1.00
R0364:Pcdhb17 UTSW 18 37485835 missense possibly damaging 0.95
R1013:Pcdhb17 UTSW 18 37485967 missense probably damaging 1.00
R1052:Pcdhb17 UTSW 18 37486846 missense probably damaging 1.00
R1226:Pcdhb17 UTSW 18 37487260 missense probably damaging 1.00
R1258:Pcdhb17 UTSW 18 37485534 missense probably damaging 0.98
R1335:Pcdhb17 UTSW 18 37486234 missense probably damaging 1.00
R1443:Pcdhb17 UTSW 18 37486648 missense probably benign 0.15
R1451:Pcdhb17 UTSW 18 37486936 missense probably damaging 1.00
R1505:Pcdhb17 UTSW 18 37486822 missense probably damaging 1.00
R1591:Pcdhb17 UTSW 18 37485825 missense probably damaging 1.00
R1742:Pcdhb17 UTSW 18 37486576 missense probably damaging 0.99
R1750:Pcdhb17 UTSW 18 37485711 missense probably damaging 1.00
R1750:Pcdhb17 UTSW 18 37487017 missense possibly damaging 0.81
R1764:Pcdhb17 UTSW 18 37487271 missense probably damaging 1.00
R1863:Pcdhb17 UTSW 18 37486111 missense probably benign 0.00
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R2095:Pcdhb17 UTSW 18 37486322 missense probably benign 0.14
R4565:Pcdhb17 UTSW 18 37486470 missense probably benign 0.14
R4658:Pcdhb17 UTSW 18 37486599 missense probably damaging 1.00
R4669:Pcdhb17 UTSW 18 37486206 missense probably damaging 0.99
R4816:Pcdhb17 UTSW 18 37487397 missense probably benign 0.39
R4910:Pcdhb17 UTSW 18 37485159 start codon destroyed possibly damaging 0.90
R5209:Pcdhb17 UTSW 18 37487461 missense probably damaging 1.00
R5248:Pcdhb17 UTSW 18 37485886 missense probably benign 0.00
R5494:Pcdhb17 UTSW 18 37487247 missense probably damaging 1.00
R5544:Pcdhb17 UTSW 18 37487421 missense possibly damaging 0.61
R5952:Pcdhb17 UTSW 18 37487080 missense probably benign 0.04
R5977:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6262:Pcdhb17 UTSW 18 37486698 missense probably damaging 1.00
R6311:Pcdhb17 UTSW 18 37486263 unclassified probably null
R6495:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6710:Pcdhb17 UTSW 18 37485399 missense probably damaging 0.96
R7097:Pcdhb17 UTSW 18 37486513 missense probably benign
R7122:Pcdhb17 UTSW 18 37486513 missense probably benign
R7130:Pcdhb17 UTSW 18 37485445 missense probably damaging 1.00
R7437:Pcdhb17 UTSW 18 37486092 missense probably benign 0.01
R7642:Pcdhb17 UTSW 18 37485726 missense probably damaging 1.00
R7703:Pcdhb17 UTSW 18 37486748 missense probably benign 0.01
R7771:Pcdhb17 UTSW 18 37486909 missense possibly damaging 0.95
R7898:Pcdhb17 UTSW 18 37485180 missense probably benign 0.00
R7981:Pcdhb17 UTSW 18 37485180 missense probably benign 0.00
X0062:Pcdhb17 UTSW 18 37486489 missense probably benign
X0064:Pcdhb17 UTSW 18 37486431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCACATCAGCTACTCG -3'
(R):5'- CATTGTCCTTGACCAGCAGG -3'

Sequencing Primer
(F):5'- GCTGTTGCCTTCCCACGAC -3'
(R):5'- TCGCTCAGCAGTCTGGTAG -3'
Posted On2016-07-06