Incidental Mutation 'R5254:Myo5b'
ID 399428
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 042825-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R5254 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74833677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 818 (I818F)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000074157
AA Change: I818F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: I818F

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121875
AA Change: I818F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: I818F

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,911,042 (GRCm39) C296* probably null Het
Adam11 T A 11: 102,665,098 (GRCm39) Y413* probably null Het
Ankhd1 A G 18: 36,789,768 (GRCm39) I907V probably benign Het
Arrdc5 A G 17: 56,604,897 (GRCm39) I130T probably benign Het
Asic5 T A 3: 81,928,294 (GRCm39) I419K probably damaging Het
Atp4a A T 7: 30,414,955 (GRCm39) E248V probably damaging Het
Avil C A 10: 126,847,630 (GRCm39) V154L probably benign Het
Bclaf1 T A 10: 20,199,282 (GRCm39) H226Q possibly damaging Het
Cald1 A G 6: 34,723,351 (GRCm39) probably benign Het
Cd200r4 A C 16: 44,652,453 (GRCm39) D27A possibly damaging Het
Cdsn T A 17: 35,863,099 (GRCm39) M1K probably null Het
Cfap46 T A 7: 139,258,430 (GRCm39) H281L possibly damaging Het
Chaf1a T C 17: 56,369,606 (GRCm39) F533L probably benign Het
Chil4 T A 3: 106,126,768 (GRCm39) I5F probably benign Het
Ctu2 A T 8: 123,203,327 (GRCm39) R48W probably damaging Het
Daam1 A T 12: 71,993,350 (GRCm39) H373L unknown Het
Dcaf10 T A 4: 45,370,415 (GRCm39) Y328N possibly damaging Het
Dst A T 1: 34,217,012 (GRCm39) K1151* probably null Het
Ect2 T C 3: 27,184,219 (GRCm39) D503G probably damaging Het
Epm2a C A 10: 11,333,089 (GRCm39) D307E probably benign Het
Exph5 A T 9: 53,249,230 (GRCm39) D73V probably damaging Het
Fam20b C T 1: 156,533,310 (GRCm39) G102D probably damaging Het
Fat2 T C 11: 55,172,001 (GRCm39) N2904S probably damaging Het
Flt3 T A 5: 147,312,500 (GRCm39) Q147L possibly damaging Het
Fndc11 A G 2: 180,863,956 (GRCm39) T254A possibly damaging Het
Galnt15 C T 14: 31,780,244 (GRCm39) R514* probably null Het
Gbgt1 A G 2: 28,395,220 (GRCm39) D286G probably damaging Het
Ggt1 T A 10: 75,415,032 (GRCm39) probably null Het
Gm26526 A T 7: 39,238,658 (GRCm39) noncoding transcript Het
H2-K2 T C 17: 34,216,436 (GRCm39) T237A probably damaging Het
Igf1r T A 7: 67,857,067 (GRCm39) S1010T probably damaging Het
Il21 T C 3: 37,281,884 (GRCm39) T87A possibly damaging Het
Kmt2b G A 7: 30,268,600 (GRCm39) R2010C probably damaging Het
Kmt2c G A 5: 25,519,592 (GRCm39) P2173S probably benign Het
Krt1 A T 15: 101,754,803 (GRCm39) S512T unknown Het
Krtap16-1 G A 11: 99,876,424 (GRCm39) R327* probably null Het
Lama1 T A 17: 68,063,711 (GRCm39) I745N probably benign Het
Lrrk1 T A 7: 65,956,855 (GRCm39) N372I probably benign Het
Lyst A T 13: 13,857,655 (GRCm39) E2481D probably benign Het
Map2k1 A T 9: 64,095,027 (GRCm39) probably benign Het
Mbip A G 12: 56,384,228 (GRCm39) V215A probably damaging Het
Mdc1 T A 17: 36,158,814 (GRCm39) V398D probably benign Het
Mog T G 17: 37,323,264 (GRCm39) I225L probably benign Het
Mrgprx3-ps T A 7: 46,959,184 (GRCm39) noncoding transcript Het
Muc5b C T 7: 141,418,277 (GRCm39) S3741L probably benign Het
Myo5a A T 9: 75,037,402 (GRCm39) I202F probably damaging Het
Nfia T A 4: 97,902,534 (GRCm39) M262K probably damaging Het
Nisch C T 14: 30,928,524 (GRCm39) probably null Het
Nkd1 A G 8: 89,315,822 (GRCm39) D64G probably damaging Het
Nt5c2 T A 19: 46,881,999 (GRCm39) K284* probably null Het
Or14a259 A T 7: 86,013,398 (GRCm39) V49E possibly damaging Het
Or4k15b C A 14: 50,272,135 (GRCm39) A242S possibly damaging Het
Or4l1 A T 14: 50,166,236 (GRCm39) I255N probably damaging Het
Or52z14 T G 7: 103,252,996 (GRCm39) I45R probably benign Het
Or5an1c A G 19: 12,218,612 (GRCm39) S138P probably damaging Het
Or5j3 A T 2: 86,128,265 (GRCm39) Y35F probably damaging Het
Or8g55 A T 9: 39,784,741 (GRCm39) T57S possibly damaging Het
Or8k24 A T 2: 86,216,484 (GRCm39) S93T possibly damaging Het
Pcdhb17 A T 18: 37,619,878 (GRCm39) D556V probably damaging Het
Pcdhga8 A T 18: 37,859,673 (GRCm39) D243V probably benign Het
Polq A T 16: 36,909,681 (GRCm39) Q2355L probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc5a4a C A 10: 76,018,572 (GRCm39) Y506* probably null Het
Sp110 G C 1: 85,504,923 (GRCm39) probably benign Het
Tarbp1 G A 8: 127,193,895 (GRCm39) H336Y probably damaging Het
Tas2r134 T G 2: 51,517,559 (GRCm39) F13V probably benign Het
Tgfb2 A G 1: 186,436,680 (GRCm39) Y98H probably damaging Het
Tmprss11a C A 5: 86,559,665 (GRCm39) V376L probably damaging Het
Tmprss11f T A 5: 86,685,892 (GRCm39) K158N probably benign Het
Tnip2 G T 5: 34,660,922 (GRCm39) Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 (GRCm39) probably null Het
Ttc28 C T 5: 111,419,104 (GRCm39) P1398S probably benign Het
Umodl1 T G 17: 31,199,333 (GRCm39) I308S possibly damaging Het
Vcan A T 13: 89,839,719 (GRCm39) S1942T probably damaging Het
Vmn2r124 T A 17: 18,283,339 (GRCm39) N344K probably benign Het
Vmn2r25 C G 6: 123,802,277 (GRCm39) C542S probably damaging Het
Wiz T A 17: 32,597,470 (GRCm39) probably benign Het
Wrap73 A G 4: 154,239,803 (GRCm39) Y343C probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GACATGAGTCAGTCCAGTGG -3'
(R):5'- GAAACTTAAAGTTCCGGGAAGCC -3'

Sequencing Primer
(F):5'- ACATGAGTCAGTCCAGTGGATTGG -3'
(R):5'- GTTCCGGGAAGCCTAATAGTTAC -3'
Posted On 2016-07-06