Incidental Mutation 'R5254:Olfr262'
ID399432
Institutional Source Beutler Lab
Gene Symbol Olfr262
Ensembl Gene ENSMUSG00000067519
Gene Nameolfactory receptor 262
SynonymsMOR214-1, GA_x6K02T2N4A9-18144-19082, MOR214-9
MMRRC Submission 042825-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5254 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12240721-12241659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12241248 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 138 (S138P)
Ref Sequence ENSEMBL: ENSMUSP00000085120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087818]
Predicted Effect probably damaging
Transcript: ENSMUST00000087818
AA Change: S138P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085120
Gene: ENSMUSG00000067519
AA Change: S138P

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.3e-55 PFAM
Pfam:7tm_1 42 291 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,458,398 C296* probably null Het
Adam11 T A 11: 102,774,272 Y413* probably null Het
Ankhd1 A G 18: 36,656,715 I907V probably benign Het
Arrdc5 A G 17: 56,297,897 I130T probably benign Het
Asic5 T A 3: 82,020,987 I419K probably damaging Het
Atp4a A T 7: 30,715,530 E248V probably damaging Het
Avil C A 10: 127,011,761 V154L probably benign Het
Bclaf1 T A 10: 20,323,536 H226Q possibly damaging Het
Cald1 A G 6: 34,746,416 probably benign Het
Cd200r4 A C 16: 44,832,090 D27A possibly damaging Het
Cdsn T A 17: 35,552,202 M1K probably null Het
Cfap46 T A 7: 139,678,514 H281L possibly damaging Het
Chaf1a T C 17: 56,062,606 F533L probably benign Het
Chil4 T A 3: 106,219,452 I5F probably benign Het
Ctu2 A T 8: 122,476,588 R48W probably damaging Het
Daam1 A T 12: 71,946,576 H373L unknown Het
Dcaf10 T A 4: 45,370,415 Y328N possibly damaging Het
Dst A T 1: 34,177,931 K1151* probably null Het
Ect2 T C 3: 27,130,070 D503G probably damaging Het
Epm2a C A 10: 11,457,345 D307E probably benign Het
Exph5 A T 9: 53,337,930 D73V probably damaging Het
Fam20b C T 1: 156,705,740 G102D probably damaging Het
Fat2 T C 11: 55,281,175 N2904S probably damaging Het
Flt3 T A 5: 147,375,690 Q147L possibly damaging Het
Fndc11 A G 2: 181,222,163 T254A possibly damaging Het
Galnt15 C T 14: 32,058,287 R514* probably null Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Ggt1 T A 10: 75,579,198 probably null Het
Gm26526 A T 7: 39,589,234 noncoding transcript Het
H2-K1 T C 17: 33,997,462 T237A probably damaging Het
Igf1r T A 7: 68,207,319 S1010T probably damaging Het
Il21 T C 3: 37,227,735 T87A possibly damaging Het
Kmt2b G A 7: 30,569,175 R2010C probably damaging Het
Kmt2c G A 5: 25,314,594 P2173S probably benign Het
Krt1 A T 15: 101,846,368 S512T unknown Het
Krtap16-1 G A 11: 99,985,598 R327* probably null Het
Lama1 T A 17: 67,756,716 I745N probably benign Het
Lrrk1 T A 7: 66,307,107 N372I probably benign Het
Lyst A T 13: 13,683,070 E2481D probably benign Het
Map2k1 A T 9: 64,187,745 probably benign Het
Mbip A G 12: 56,337,443 V215A probably damaging Het
Mdc1 T A 17: 35,847,922 V398D probably benign Het
Mog T G 17: 37,012,372 I225L probably benign Het
Mrgprx3-ps T A 7: 47,309,436 noncoding transcript Het
Muc5b C T 7: 141,864,540 S3741L probably benign Het
Myo5a A T 9: 75,130,120 I202F probably damaging Het
Myo5b A T 18: 74,700,606 I818F possibly damaging Het
Nfia T A 4: 98,014,297 M262K probably damaging Het
Nisch C T 14: 31,206,567 probably null Het
Nkd1 A G 8: 88,589,194 D64G probably damaging Het
Nt5c2 T A 19: 46,893,560 K284* probably null Het
Olfr1052 A T 2: 86,297,921 Y35F probably damaging Het
Olfr1058 A T 2: 86,386,140 S93T possibly damaging Het
Olfr305 A T 7: 86,364,190 V49E possibly damaging Het
Olfr619 T G 7: 103,603,789 I45R probably benign Het
Olfr723 A T 14: 49,928,779 I255N probably damaging Het
Olfr725 C A 14: 50,034,678 A242S possibly damaging Het
Olfr972 A T 9: 39,873,445 T57S possibly damaging Het
Pcdhb17 A T 18: 37,486,825 D556V probably damaging Het
Pcdhga8 A T 18: 37,726,620 D243V probably benign Het
Polq A T 16: 37,089,319 Q2355L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc5a4a C A 10: 76,182,738 Y506* probably null Het
Sp110 G C 1: 85,577,202 probably benign Het
Tarbp1 G A 8: 126,467,156 H336Y probably damaging Het
Tas2r134 T G 2: 51,627,547 F13V probably benign Het
Tgfb2 A G 1: 186,704,483 Y98H probably damaging Het
Tmprss11a C A 5: 86,411,806 V376L probably damaging Het
Tmprss11f T A 5: 86,538,033 K158N probably benign Het
Tnip2 G T 5: 34,503,578 Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 probably null Het
Ttc28 C T 5: 111,271,238 P1398S probably benign Het
Umodl1 T G 17: 30,980,359 I308S possibly damaging Het
Vcan A T 13: 89,691,600 S1942T probably damaging Het
Vmn2r124 T A 17: 18,063,077 N344K probably benign Het
Vmn2r25 C G 6: 123,825,318 C542S probably damaging Het
Wiz T A 17: 32,378,496 probably benign Het
Wrap73 A G 4: 154,155,346 Y343C probably benign Het
Other mutations in Olfr262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr262 APN 19 12241527 missense probably damaging 0.99
IGL02170:Olfr262 APN 19 12240756 missense probably benign
IGL02748:Olfr262 APN 19 12240840 missense probably benign 0.01
IGL02896:Olfr262 APN 19 12240989 nonsense probably null
R0365:Olfr262 UTSW 19 12241076 missense probably benign 0.13
R0374:Olfr262 UTSW 19 12241141 missense probably damaging 1.00
R1226:Olfr262 UTSW 19 12241586 missense probably benign
R1319:Olfr262 UTSW 19 12241502 missense probably damaging 1.00
R1426:Olfr262 UTSW 19 12241182 missense possibly damaging 0.81
R1453:Olfr262 UTSW 19 12241592 missense probably benign
R1675:Olfr262 UTSW 19 12240831 missense probably benign 0.37
R1773:Olfr262 UTSW 19 12241659 start codon destroyed probably null 0.03
R1778:Olfr262 UTSW 19 12241455 missense probably benign
R1820:Olfr262 UTSW 19 12241248 missense probably damaging 1.00
R3161:Olfr262 UTSW 19 12241496 missense probably benign 0.06
R3412:Olfr262 UTSW 19 12241590 missense probably benign 0.00
R4387:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4389:Olfr262 UTSW 19 12241139 missense probably damaging 0.98
R4782:Olfr262 UTSW 19 12241572 missense probably benign 0.01
R4885:Olfr262 UTSW 19 12240718 unclassified probably null
R4915:Olfr262 UTSW 19 12241373 missense probably benign 0.31
R5726:Olfr262 UTSW 19 12241280 missense probably damaging 0.99
R6579:Olfr262 UTSW 19 12241362 missense probably benign
R7062:Olfr262 UTSW 19 12240725 missense probably benign
R7424:Olfr262 UTSW 19 12240954 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGAAAGTGTCTGTGCAGGAC -3'
(R):5'- AACTCTCACCTGGAATCTGTC -3'

Sequencing Primer
(F):5'- GACAGAACTAACAACTGTGGCATGTC -3'
(R):5'- GCTATGTTACCAGTACAGTCCC -3'
Posted On2016-07-06