Incidental Mutation 'R5178:Olfr1178'
ID399448
Institutional Source Beutler Lab
Gene Symbol Olfr1178
Ensembl Gene ENSMUSG00000056995
Gene Nameolfactory receptor 1178
SynonymsGA_x6K02T2Q125-49870417-49871388, MOR225-6P
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88387062-88400799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88391475 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 76 (T76I)
Ref Sequence ENSEMBL: ENSMUSP00000150036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075640] [ENSMUST00000214040]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075640
AA Change: T76I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075066
Gene: ENSMUSG00000056995
AA Change: T76I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-49 PFAM
Pfam:7tm_1 39 285 7.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214040
AA Change: T76I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219086
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Olfr1178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr1178 APN 2 88391901 missense possibly damaging 0.79
IGL02261:Olfr1178 APN 2 88391381 missense probably benign 0.05
IGL03023:Olfr1178 APN 2 88391343 missense probably damaging 1.00
IGL03053:Olfr1178 APN 2 88391594 missense probably damaging 1.00
IGL03168:Olfr1178 APN 2 88391594 missense probably damaging 1.00
R0432:Olfr1178 UTSW 2 88392033 missense probably damaging 0.98
R1738:Olfr1178 UTSW 2 88391327 missense probably benign 0.01
R2051:Olfr1178 UTSW 2 88391538 missense possibly damaging 0.49
R2136:Olfr1178 UTSW 2 88391319 missense probably benign 0.24
R3236:Olfr1178 UTSW 2 88391406 missense probably benign 0.01
R4407:Olfr1178 UTSW 2 88392083 missense probably benign 0.37
R4930:Olfr1178 UTSW 2 88391940 missense probably benign 0.12
R4959:Olfr1178 UTSW 2 88391330 missense probably benign 0.37
R4973:Olfr1178 UTSW 2 88391330 missense probably benign 0.37
R5411:Olfr1178 UTSW 2 88391261 missense probably benign 0.01
R6282:Olfr1178 UTSW 2 88391533 nonsense probably null
R7289:Olfr1178 UTSW 2 88391706 missense probably damaging 0.99
R7493:Olfr1178 UTSW 2 88391880 missense possibly damaging 0.94
R7591:Olfr1178 UTSW 2 88391876 missense probably benign 0.17
R8060:Olfr1178 UTSW 2 88391504 missense not run
Z1176:Olfr1178 UTSW 2 88392033 missense not run
Predicted Primers PCR Primer
(F):5'- TCACAGAATTTATTCTCCTAGGGC -3'
(R):5'- ACAGCATCACACTTCTGCCTG -3'

Sequencing Primer
(F):5'- TCTCCTAGGGCTTTCTCAGACAAAAG -3'
(R):5'- ACTTCTGCCTGCTCATAAGGATGG -3'
Posted On2016-07-06