Incidental Mutation 'R5255:Olfr1303'
ID399451
Institutional Source Beutler Lab
Gene Symbol Olfr1303
Ensembl Gene ENSMUSG00000093804
Gene Nameolfactory receptor 1303
SynonymsMOR245-7, MOR245-7, Olfr276, GA_x6K02T2N82Q-3465-3764, GA_x6K02T2Q125-72882187-72881249, MOR245-28_p
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111812247-111820340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111814178 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 183 (K183E)
Ref Sequence ENSEMBL: ENSMUSP00000149015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099609] [ENSMUST00000216114]
Predicted Effect probably benign
Transcript: ENSMUST00000099609
AA Change: K183E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097204
Gene: ENSMUSG00000093804
AA Change: K183E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.3e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 302 2.5e-6 PFAM
Pfam:7tm_1 41 287 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216114
AA Change: K183E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Olfr1303
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr1303 APN 2 111813781 utr 3 prime probably benign
IGL02442:Olfr1303 APN 2 111813991 missense probably benign 0.26
IGL02563:Olfr1303 APN 2 111813817 missense probably benign
IGL03064:Olfr1303 APN 2 111814423 missense possibly damaging 0.86
R0081:Olfr1303 UTSW 2 111813868 missense probably damaging 1.00
R0139:Olfr1303 UTSW 2 111814354 missense possibly damaging 0.54
R0624:Olfr1303 UTSW 2 111814711 missense probably damaging 1.00
R0926:Olfr1303 UTSW 2 111814547 missense probably damaging 1.00
R1436:Olfr1303 UTSW 2 111814561 missense probably damaging 1.00
R2099:Olfr1303 UTSW 2 111813832 missense probably benign 0.18
R6034:Olfr1303 UTSW 2 111814357 missense probably damaging 1.00
R6034:Olfr1303 UTSW 2 111814357 missense probably damaging 1.00
R6101:Olfr1303 UTSW 2 111814253 missense probably benign 0.00
R6385:Olfr1303 UTSW 2 111814619 missense probably benign
R6489:Olfr1303 UTSW 2 111814060 missense probably damaging 1.00
R6978:Olfr1303 UTSW 2 111813810 missense probably benign 0.03
R7410:Olfr1303 UTSW 2 111813926 missense probably benign 0.00
Z1176:Olfr1303 UTSW 2 111814034 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCACTGTGATGTGAGCTGAAAG -3'
(R):5'- CTACTTGTGGCCATGGCATTTG -3'

Sequencing Primer
(F):5'- CTGTGATGTGAGCTGAAAGAGTGG -3'
(R):5'- GGCCATGGCATTTGACAGATATATAG -3'
Posted On2016-07-06