Incidental Mutation 'R5178:Mmp17'
ID399460
Institutional Source Beutler Lab
Gene Symbol Mmp17
Ensembl Gene ENSMUSG00000029436
Gene Namematrix metallopeptidase 17
Synonymsmembrane type-4 matrix metalloproteinase, MT4-MMP
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129584169-129611099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129595058 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 132 (W132R)
Ref Sequence ENSEMBL: ENSMUSP00000031390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031390]
Predicted Effect probably damaging
Transcript: ENSMUST00000031390
AA Change: W132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031390
Gene: ENSMUSG00000029436
AA Change: W132R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:PG_binding_1 44 104 5e-15 PFAM
ZnMc 128 295 8.26e-47 SMART
low complexity region 308 320 N/A INTRINSIC
HX 340 384 3.17e-8 SMART
HX 389 432 2.59e-13 SMART
HX 435 481 6.39e-13 SMART
HX 483 527 1.1e-7 SMART
low complexity region 563 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177802
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 3604575; 3777020
FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit dysfunctional vascular smooth muscle cells and altered extracellular matrix in the vessel wall leading to an increased susceptibility to angiotensin-II-induced thoracic aortic aneurysm. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal morphology, clinical chemistry, hematology and behavior. Mice homozygous for a reporter/null allele exhibit normal growth, fertility, and lifespan but show subtle renal developmental defects, hypodipsia, and elevated urine osmolarity. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Mmp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mmp17 APN 5 129606408 missense probably benign 0.00
IGL01602:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01605:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01782:Mmp17 APN 5 129602141 missense probably damaging 1.00
IGL01986:Mmp17 APN 5 129596628 missense probably damaging 1.00
IGL02096:Mmp17 APN 5 129598688 nonsense probably null
IGL02160:Mmp17 APN 5 129595569 missense possibly damaging 0.91
IGL03075:Mmp17 APN 5 129595074 missense probably damaging 1.00
P0005:Mmp17 UTSW 5 129596631 missense probably benign 0.00
R0125:Mmp17 UTSW 5 129594582 missense possibly damaging 0.88
R0553:Mmp17 UTSW 5 129598670 missense probably benign 0.30
R1521:Mmp17 UTSW 5 129595088 splice site probably null
R1938:Mmp17 UTSW 5 129602126 missense probably damaging 1.00
R2151:Mmp17 UTSW 5 129605661 missense probably benign 0.01
R4908:Mmp17 UTSW 5 129605666 nonsense probably null
R4970:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5096:Mmp17 UTSW 5 129605563 missense probably damaging 1.00
R5112:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5304:Mmp17 UTSW 5 129594614 missense probably null 0.89
R5341:Mmp17 UTSW 5 129602129 missense possibly damaging 0.50
R6341:Mmp17 UTSW 5 129601955 missense probably damaging 0.99
R6501:Mmp17 UTSW 5 129606405 missense probably benign 0.00
R7257:Mmp17 UTSW 5 129595633 missense probably benign 0.03
R7371:Mmp17 UTSW 5 129605772 missense probably null 0.98
R7546:Mmp17 UTSW 5 129596589 missense probably damaging 1.00
R8026:Mmp17 UTSW 5 129595084 critical splice donor site probably null
W0251:Mmp17 UTSW 5 129595527 missense probably benign 0.09
Y5377:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Y5380:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Z1177:Mmp17 UTSW 5 129595661 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACTTGACTGGATATGCGGGG -3'
(R):5'- ATGGCCTGGGTGATAAGATTTC -3'

Sequencing Primer
(F):5'- GAGATTGAACACACCTGGCCTTG -3'
(R):5'- ATAAGATTTCTCAGGGCCGGC -3'
Posted On2016-07-06