Incidental Mutation 'R5178:Gpc2'
ID399462
Institutional Source Beutler Lab
Gene Symbol Gpc2
Ensembl Gene ENSMUSG00000029510
Gene Nameglypican 2 (cerebroglycan)
Synonyms
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138273655-138280005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 138275605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 444 (V444L)
Ref Sequence ENSEMBL: ENSMUSP00000124459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014089] [ENSMUST00000048028] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000160729] [ENSMUST00000161279] [ENSMUST00000161647] [ENSMUST00000161665] [ENSMUST00000161691] [ENSMUST00000161827] [ENSMUST00000161984] [ENSMUST00000162245]
Predicted Effect probably benign
Transcript: ENSMUST00000014089
AA Change: V444L

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000014089
Gene: ENSMUSG00000029510
AA Change: V444L

DomainStartEndE-ValueType
Pfam:Glypican 7 560 2.8e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048028
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100530
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159689
Predicted Effect probably benign
Transcript: ENSMUST00000160729
SMART Domains Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably benign
Transcript: ENSMUST00000161279
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161647
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161665
SMART Domains Protein: ENSMUSP00000124682
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161691
SMART Domains Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161827
AA Change: V444L

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124459
Gene: ENSMUSG00000029510
AA Change: V444L

DomainStartEndE-ValueType
Pfam:Glypican 11 566 3.1e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161984
SMART Domains Protein: ENSMUSP00000137879
Gene: ENSMUSG00000029510

DomainStartEndE-ValueType
Pfam:Glypican 7 342 3.7e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162245
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162909
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Gpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Gpc2 APN 5 138274309 utr 3 prime probably benign
IGL00938:Gpc2 APN 5 138278907 missense probably benign 0.08
IGL01315:Gpc2 APN 5 138276039 missense probably benign 0.00
IGL01583:Gpc2 APN 5 138275530 missense probably damaging 1.00
IGL01590:Gpc2 APN 5 138274378 missense probably damaging 0.99
IGL02040:Gpc2 APN 5 138276582 critical splice donor site probably null
IGL02322:Gpc2 APN 5 138276237 unclassified probably null
IGL02655:Gpc2 APN 5 138278925 missense possibly damaging 0.73
R0638:Gpc2 UTSW 5 138278534 missense possibly damaging 0.79
R1004:Gpc2 UTSW 5 138278225 missense probably damaging 1.00
R1918:Gpc2 UTSW 5 138278379 missense probably benign 0.01
R4177:Gpc2 UTSW 5 138277359 unclassified probably benign
R4361:Gpc2 UTSW 5 138278290 nonsense probably null
R5250:Gpc2 UTSW 5 138278968 missense probably damaging 1.00
R5365:Gpc2 UTSW 5 138275623 missense probably damaging 1.00
R6182:Gpc2 UTSW 5 138278414 missense probably benign 0.01
R6548:Gpc2 UTSW 5 138277271 intron probably null
R6985:Gpc2 UTSW 5 138278408 missense probably damaging 1.00
R7064:Gpc2 UTSW 5 138278910 missense probably damaging 1.00
R7821:Gpc2 UTSW 5 138276297 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACTTGGGAAGCAATGGACC -3'
(R):5'- CTGTAACCGTATGTGGGGACTC -3'

Sequencing Primer
(F):5'- CAAGGGGCCTTGCAGAGTG -3'
(R):5'- GGGGACTCCCGCATGGC -3'
Posted On2016-07-06