Incidental Mutation 'R5178:Gm15922'
ID399467
Institutional Source Beutler Lab
Gene Symbol Gm15922
Ensembl Gene ENSMUSG00000081665
Gene Namepredicted gene 15922
Synonyms
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3733021-3739861 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 3739397 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 44 (K44*)
Ref Sequence ENSEMBL: ENSMUSP00000145713 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000118068
AA Change: K44*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Gm15922
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1514:Gm15922 UTSW 7 3739640 missense possibly damaging 0.82
R3902:Gm15922 UTSW 7 3737277 missense probably damaging 0.99
R4246:Gm15922 UTSW 7 3737349 missense probably damaging 1.00
R5125:Gm15922 UTSW 7 3739397 nonsense probably null
R5388:Gm15922 UTSW 7 3738857 missense possibly damaging 0.49
R5471:Gm15922 UTSW 7 3735515 missense probably benign 0.02
R5985:Gm15922 UTSW 7 3737317 missense probably damaging 1.00
R6248:Gm15922 UTSW 7 3736338 missense probably benign
R6360:Gm15922 UTSW 7 3736504 missense probably damaging 1.00
R6451:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6453:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6454:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6455:Gm15922 UTSW 7 3738931 missense probably benign 0.00
R6594:Gm15922 UTSW 7 3736499 nonsense probably null
R6654:Gm15922 UTSW 7 3735929 missense probably benign 0.19
R6813:Gm15922 UTSW 7 3736003 missense probably benign 0.03
R6972:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6975:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7069:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7072:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7188:Gm15922 UTSW 7 3738829 missense probably damaging 0.99
R7304:Gm15922 UTSW 7 3737494 missense probably damaging 1.00
R7329:Gm15922 UTSW 7 3739876 start gained probably benign
R7404:Gm15922 UTSW 7 3739345 missense probably damaging 1.00
R7454:Gm15922 UTSW 7 3735510 missense probably benign 0.03
R7493:Gm15922 UTSW 7 3739024 missense not run
R7655:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7656:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCCTGATGATTCATCCTGGG -3'
(R):5'- TTCATATCCAGGAGCCATGCC -3'

Sequencing Primer
(F):5'- GTGCTGTAGGAACATCGATATTGACC -3'
(R):5'- CCATGCCTGGGCTGTGATG -3'
Posted On2016-07-06