Incidental Mutation 'R5178:Lair1'
ID399468
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Nameleukocyte-associated Ig-like receptor 1
SynonymsmLair-1, Lair-1, 5133400O11Rik, D7Bwg0421e
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4003402-4063204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4010489 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 82 (T82I)
Ref Sequence ENSEMBL: ENSMUSP00000070712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]
PDB Structure
Crystal structure of a strand-swapped dimer of Mouse Leukocyte-associated immunoglobulin-like receptor 1 (NYSGRC-006047)IG-like domain [X-RAY DIFFRACTION]
Crystal structure of a strand-swapped dimer of Mouse Leukocyte-associated immunoglobulin-like receptor 1 (NYSGRC-006047) Extra Cellular Domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068865
AA Change: T82I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541
AA Change: T82I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086400
AA Change: T192I

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: T192I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086401
AA Change: T192I

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: T192I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108600
AA Change: T153I

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541
AA Change: T153I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131126
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136616
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149395
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205296
AA Change: T43I

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206445
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4028731 missense probably benign 0.01
IGL01475:Lair1 APN 7 4009684 utr 3 prime probably benign
IGL02696:Lair1 APN 7 4010849 intron probably benign
IGL02749:Lair1 APN 7 4028901 missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4010786 missense probably damaging 1.00
R0703:Lair1 UTSW 7 4010760 missense probably null 0.99
R1053:Lair1 UTSW 7 4028785 missense probably damaging 1.00
R1332:Lair1 UTSW 7 4010596 missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4010789 missense probably damaging 1.00
R2022:Lair1 UTSW 7 4063064 splice site probably null
R2509:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R3721:Lair1 UTSW 7 4010783 missense probably damaging 1.00
R4021:Lair1 UTSW 7 4055916 critical splice donor site probably null
R4784:Lair1 UTSW 7 4009732 missense probably benign 0.15
R4873:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4875:Lair1 UTSW 7 4029034 missense probably benign 0.05
R4940:Lair1 UTSW 7 4028949 missense probably benign 0.00
R5125:Lair1 UTSW 7 4010489 missense possibly damaging 0.92
R5888:Lair1 UTSW 7 4010845 missense probably damaging 0.96
R5965:Lair1 UTSW 7 4029024 missense possibly damaging 0.46
R6119:Lair1 UTSW 7 4028896 missense probably benign 0.43
R6265:Lair1 UTSW 7 4055827 intron probably benign
R6305:Lair1 UTSW 7 4010728 critical splice donor site probably null
R6915:Lair1 UTSW 7 4055953 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCATCTGTCCTCAGGAAGC -3'
(R):5'- TCCCTCCTAAATGTGAACTGATTC -3'

Sequencing Primer
(F):5'- GGAAGCCTGTCATCTGCAACTATG -3'
(R):5'- GTGAACTGATTCTGACTATTCTCAGG -3'
Posted On2016-07-06