Incidental Mutation 'R5255:Zfp12'
ID399469
Institutional Source Beutler Lab
Gene Symbol Zfp12
Ensembl Gene ENSMUSG00000029587
Gene Namezinc finger protein 12
SynonymsZfp-12, Krox-7
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143235163-143248834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143240379 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 68 (I68L)
Ref Sequence ENSEMBL: ENSMUSP00000032591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032591] [ENSMUST00000075916] [ENSMUST00000077485] [ENSMUST00000162861]
Predicted Effect probably null
Transcript: ENSMUST00000032591
AA Change: I68L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032591
Gene: ENSMUSG00000029587
AA Change: I68L

DomainStartEndE-ValueType
KRAB 8 68 1.98e-36 SMART
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 263 285 4.47e-3 SMART
ZnF_C2H2 291 313 2.43e-4 SMART
ZnF_C2H2 319 341 2.61e-4 SMART
ZnF_C2H2 347 369 1.04e-3 SMART
ZnF_C2H2 375 397 6.08e-5 SMART
ZnF_C2H2 403 425 2.99e-4 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 2.57e-3 SMART
ZnF_C2H2 487 509 6.32e-3 SMART
ZnF_C2H2 515 537 5.21e-4 SMART
ZnF_C2H2 543 565 9.44e-2 SMART
ZnF_C2H2 571 593 1.72e-4 SMART
ZnF_C2H2 599 621 2.86e-1 SMART
ZnF_C2H2 627 649 3.63e-3 SMART
ZnF_C2H2 655 677 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075916
SMART Domains Protein: ENSMUSP00000137971
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 67 6.65e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000077485
SMART Domains Protein: ENSMUSP00000076693
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 68 8.91e-21 SMART
low complexity region 156 167 N/A INTRINSIC
Pfam:zf-C2H2_6 183 200 8.8e-1 PFAM
ZnF_C2H2 231 253 4.47e-3 SMART
ZnF_C2H2 259 281 2.43e-4 SMART
ZnF_C2H2 287 309 2.61e-4 SMART
ZnF_C2H2 315 337 1.04e-3 SMART
ZnF_C2H2 343 365 6.08e-5 SMART
ZnF_C2H2 371 393 2.99e-4 SMART
ZnF_C2H2 399 421 9.08e-4 SMART
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 6.32e-3 SMART
ZnF_C2H2 483 505 5.21e-4 SMART
ZnF_C2H2 511 533 9.44e-2 SMART
ZnF_C2H2 539 561 1.72e-4 SMART
ZnF_C2H2 567 589 2.86e-1 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160195
Predicted Effect probably null
Transcript: ENSMUST00000162861
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with eight C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in developmental control of gene expression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Zfp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Zfp12 APN 5 143244796 missense probably damaging 1.00
IGL02870:Zfp12 APN 5 143245331 missense probably damaging 0.99
IGL02975:Zfp12 APN 5 143244059 unclassified probably benign
R0362:Zfp12 UTSW 5 143245223 missense probably damaging 0.97
R0723:Zfp12 UTSW 5 143244883 missense probably damaging 1.00
R1104:Zfp12 UTSW 5 143245745 missense probably damaging 1.00
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1774:Zfp12 UTSW 5 143245229 missense probably damaging 1.00
R1895:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R1946:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R2280:Zfp12 UTSW 5 143245493 missense probably damaging 0.99
R3824:Zfp12 UTSW 5 143240322 missense probably benign 0.12
R4772:Zfp12 UTSW 5 143240000 missense probably damaging 1.00
R4786:Zfp12 UTSW 5 143245502 missense probably damaging 0.99
R5496:Zfp12 UTSW 5 143244795 nonsense probably null
R5542:Zfp12 UTSW 5 143244485 missense possibly damaging 0.75
R5637:Zfp12 UTSW 5 143245696 missense probably damaging 1.00
R5742:Zfp12 UTSW 5 143245190 missense probably damaging 1.00
R5907:Zfp12 UTSW 5 143239988 missense probably damaging 1.00
R6701:Zfp12 UTSW 5 143244464 missense probably benign 0.21
R7166:Zfp12 UTSW 5 143245502 missense possibly damaging 0.85
R7188:Zfp12 UTSW 5 143239994 missense probably damaging 0.99
R7285:Zfp12 UTSW 5 143244689 missense probably damaging 1.00
R7404:Zfp12 UTSW 5 143240344 missense probably damaging 1.00
R7902:Zfp12 UTSW 5 143245780 missense probably damaging 0.99
R7985:Zfp12 UTSW 5 143245780 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGACTCCCAGAAGGTCTTGAC -3'
(R):5'- CAGCTAGGAACCTTTGATTGTGG -3'

Sequencing Primer
(F):5'- AGGTCTTGACCTTTCTGTGAAAC -3'
(R):5'- CTAGGAACCTTTGATTGTGGGTAGTG -3'
Posted On2016-07-06