Mutagenetix > Incidental Mutation

Incidental Mutation 'R5255:Arhgef1'

399473

Institutional Source

Beutler Lab

Gene Symbol

Arhgef1

Ensembl Gene

ENSMUSG00000040940

Gene Name

Rho guanine nucleotide exchange factor (GEF) 1

Synonyms

Lbcl2, Lsc

MMRRC Submission

042826-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.508) question?

Stock #

R5255 (G1)

Quality Score

177

Status

Not validated

Chromosome

Chromosomal Location

24902912-24926594 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24925022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 824 (A824T)

Ref Sequence

ENSEMBL: ENSMUSP00000096280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508] [ENSMUST00000206705]

AlphaFold

Q61210

Predicted Effect

probably benign
Transcript: ENSMUST00000047873
AA Change: A765T

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: A765T

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098683
AA Change: A824T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: A824T

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	2.2e-78	PFAM
PDB:3ODW\|B	238	384	2e-57	PDB
low complexity region	396	412	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
RhoGEF	478	662	1.87e-63	SMART
PH	706	820	4.68e-5	SMART
low complexity region	904	923	N/A	INTRINSIC
coiled coil region	926	949	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117419
AA Change: A765T

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: A765T

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	1.3e-72	PFAM
low complexity region	380	400	N/A	INTRINSIC
RhoGEF	419	603	1.87e-63	SMART
PH	647	761	4.68e-5	SMART
low complexity region	845	864	N/A	INTRINSIC
coiled coil region	867	890	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117796
AA Change: A821T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: A821T

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:RGS-like	40	230	7.3e-73	PFAM
low complexity region	393	409	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
RhoGEF	475	659	1.87e-63	SMART
PH	703	817	4.68e-5	SMART
low complexity region	901	920	N/A	INTRINSIC
coiled coil region	923	946	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126484

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129928

Predicted Effect

probably benign
Transcript: ENSMUST00000132751
AA Change: A525T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940
AA Change: A525T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	70	89	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
low complexity region	140	160	N/A	INTRINSIC
RhoGEF	179	363	1.87e-63	SMART
PH	407	521	4.68e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132786

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145783

Predicted Effect

probably benign
Transcript: ENSMUST00000205295

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206508
AA Change: A764T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000206705

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	T	17: 33,066,765	C354*	probably null	Het
Abcf1	A	T	17: 35,959,737		probably null	Het
Abr	T	A	11: 76,455,683	E434V	probably damaging	Het
Acaca	T	A	11: 84,311,307	L197Q	probably damaging	Het
Acot10	A	G	15: 20,665,932	I241T	probably benign	Het
Acp6	T	C	3: 97,167,996	V182A	probably benign	Het
Ahnak2	G	A	12: 112,773,378	T1420I	possibly damaging	Het
Akr1c6	A	T	13: 4,447,019	K153N	probably benign	Het
Ank3	T	C	10: 69,885,200	L600P	probably damaging	Het
B230307C23Rik	T	A	16: 98,008,691	N22K	possibly damaging	Het
Btn1a1	A	G	13: 23,464,154		probably benign	Het
Cenpf	G	A	1: 189,672,627	T352I	possibly damaging	Het
Ces4a	C	A	8: 105,142,489	F185L	probably benign	Het
Clybl	A	C	14: 122,384,279	E293A	probably benign	Het
Cobl	A	G	11: 12,375,825	W217R	probably damaging	Het
D430041D05Rik	T	C	2: 104,256,600	N677S	probably benign	Het
Ddx51	C	A	5: 110,656,042	T390N	possibly damaging	Het
Drd5	T	G	5: 38,319,967	V101G	probably damaging	Het
Elmo3	C	T	8: 105,307,353	P244L	probably benign	Het
Esrrg	G	A	1: 188,146,358	R189H	probably damaging	Het
Fxr2	A	G	11: 69,643,841	T183A	probably benign	Het
Gjd4	T	C	18: 9,280,613	H155R	probably benign	Het
Hivep2	T	A	10: 14,131,267		probably null	Het
Ints10	T	C	8: 68,793,972		probably benign	Het
Kank4	T	C	4: 98,778,972	T413A	probably benign	Het
Mapkbp1	T	C	2: 120,017,254	V568A	probably damaging	Het
Mobp	A	G	9: 120,168,353		probably benign	Het
Mpst	A	G	15: 78,410,508	S147G	probably benign	Het
Myo5b	A	T	18: 74,662,670	Y559F	possibly damaging	Het
Nceh1	T	C	3: 27,183,139	I21T	probably damaging	Het
Olfr1303	T	C	2: 111,814,178	K183E	probably benign	Het
Ralgps1	A	T	2: 33,276,159	V126E	probably damaging	Het
Rnls	A	G	19: 33,382,423	V115A	probably damaging	Het
Scn1a	A	T	2: 66,277,669	V1554D	probably damaging	Het
Slc16a11	T	A	11: 70,215,432	D165E	probably damaging	Het
Slc16a5	A	G	11: 115,462,675	T23A	probably benign	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc3a1	A	T	17: 85,028,453		probably null	Het
Slitrk6	A	T	14: 110,749,753	*841K	probably null	Het
Syngr1	A	G	15: 80,091,446	Y18C	possibly damaging	Het
Tarbp1	T	G	8: 126,428,970	D1343A	probably benign	Het
Vac14	T	A	8: 110,634,329	I177N	probably damaging	Het
Vmn1r218	A	T	13: 23,136,711	D76V	possibly damaging	Het
Wdr75	T	A	1: 45,799,117	I62N	probably damaging	Het
Zfp12	A	T	5: 143,240,379	I68L	probably null	Het
Zswim8	T	A	14: 20,721,651	Y1551N	probably damaging	Het

Other mutations in Arhgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Arhgef1	APN	7	24908359	missense	possibly damaging	0.93
IGL00901:Arhgef1	APN	7	24912693	missense	probably damaging	1.00
IGL01139:Arhgef1	APN	7	24925951	unclassified	probably benign
IGL01479:Arhgef1	APN	7	24912603	missense	probably benign	0.01
IGL01935:Arhgef1	APN	7	24921882	missense	probably damaging	1.00
IGL01944:Arhgef1	APN	7	24925783	critical splice acceptor site	probably null
IGL02032:Arhgef1	APN	7	24923371	missense	probably benign	0.23
IGL02059:Arhgef1	APN	7	24912552	splice site	probably benign
IGL02202:Arhgef1	APN	7	24913429	nonsense	probably null
IGL02324:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL02328:Arhgef1	APN	7	24923815	missense	probably damaging	1.00
IGL03027:Arhgef1	APN	7	24923732	missense	probably damaging	0.98
IGL03227:Arhgef1	APN	7	24922851	missense	probably damaging	1.00
IGL03404:Arhgef1	APN	7	24916843	missense	probably benign	0.07
BB009:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
BB019:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R0082:Arhgef1	UTSW	7	24912605	nonsense	probably null
R0277:Arhgef1	UTSW	7	24923799	unclassified	probably benign
R0336:Arhgef1	UTSW	7	24921957	missense	possibly damaging	0.77
R0494:Arhgef1	UTSW	7	24919360	intron	probably benign
R0668:Arhgef1	UTSW	7	24907920	missense	possibly damaging	0.63
R1520:Arhgef1	UTSW	7	24919704	missense	probably damaging	1.00
R1531:Arhgef1	UTSW	7	24924998	missense	probably damaging	0.99
R1656:Arhgef1	UTSW	7	24913632	missense	probably damaging	1.00
R2979:Arhgef1	UTSW	7	24907751	missense	unknown
R3855:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R3856:Arhgef1	UTSW	7	24919272	missense	probably damaging	1.00
R4080:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4081:Arhgef1	UTSW	7	24925846	missense	probably damaging	0.96
R4583:Arhgef1	UTSW	7	24912571	missense	probably benign	0.09
R4750:Arhgef1	UTSW	7	24918576	intron	probably benign
R4914:Arhgef1	UTSW	7	24923839	missense	probably damaging	1.00
R5275:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5295:Arhgef1	UTSW	7	24919352	critical splice donor site	probably null
R5430:Arhgef1	UTSW	7	24912307	splice site	probably null
R5604:Arhgef1	UTSW	7	24912785	missense	probably benign	0.09
R6150:Arhgef1	UTSW	7	24919357	splice site	probably null
R6151:Arhgef1	UTSW	7	24917942	missense	probably benign	0.00
R6788:Arhgef1	UTSW	7	24919780	splice site	probably null
R6943:Arhgef1	UTSW	7	24923731	missense	probably benign	0.01
R6988:Arhgef1	UTSW	7	24916923	missense	probably benign	0.04
R7422:Arhgef1	UTSW	7	24916036	missense	probably benign	0.00
R7701:Arhgef1	UTSW	7	24912578	missense	probably benign	0.01
R7706:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7707:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7708:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7932:Arhgef1	UTSW	7	24919710	missense	probably damaging	1.00
R7967:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7970:Arhgef1	UTSW	7	24916881	missense	probably damaging	1.00
R7995:Arhgef1	UTSW	7	24919216	missense	probably damaging	0.99
R8029:Arhgef1	UTSW	7	24919738	missense	probably damaging	1.00
R8132:Arhgef1	UTSW	7	24907662	intron	probably benign
R8132:Arhgef1	UTSW	7	24919749	nonsense	probably null
R8168:Arhgef1	UTSW	7	24925406	missense	probably benign	0.06
R8964:Arhgef1	UTSW	7	24923037	missense	probably damaging	1.00
R9114:Arhgef1	UTSW	7	24907879	missense	probably damaging	1.00
R9553:Arhgef1	UTSW	7	24919690	missense	probably damaging	1.00
R9676:Arhgef1	UTSW	7	24926076	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGATATATGAGCTGGTGGCAC -3'
(R):5'- AAGTGACAGGTGACCCCGTATC -3'

Sequencing Primer
(F):5'- TGGTGGCACAGACATCTTC -3'
(R):5'- GTATCCCTGGCCCAAAGACG -3'

Posted On

2016-07-06