Incidental Mutation 'R5255:Vac14'
ID399487
Institutional Source Beutler Lab
Gene Symbol Vac14
Ensembl Gene ENSMUSG00000010936
Gene NameVac14 homolog (S. cerevisiae)
SynonymsTax1bp2, ingls, D8Wsu151e, Trx
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110618585-110720398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110634329 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 177 (I177N)
Ref Sequence ENSEMBL: ENSMUSP00000148548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034190] [ENSMUST00000212829] [ENSMUST00000213003]
Predicted Effect probably damaging
Transcript: ENSMUST00000034190
AA Change: I177N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034190
Gene: ENSMUSG00000010936
AA Change: I177N

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 67 163 5.3e-43 PFAM
Pfam:Vac14_Fig4_bd 542 720 6.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212766
Predicted Effect probably damaging
Transcript: ENSMUST00000212829
AA Change: I177N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000213003
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The content of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) in endosomal membranes changes dynamically with fission and fusion events that generate or absorb intracellular transport vesicles. VAC14 is a component of a trimolecular complex that tightly regulates the level of PtdIns(3,5)P2. Other components of this complex are the PtdIns(3,5)P2-synthesizing enzyme PIKFYVE (MIM 609414) and the PtdIns(3,5)P2 phosphatase FIG4 (MIM 609390). VAC14 functions as an activator of PIKFYVE (Sbrissa et al., 2007 [PubMed 17556371]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display early postnatal lethality with lesions in multiple regions of the brain. Mice homozygous for a hypomorphic allele exhibit postnatal lethality, spongiform degeneration, enlarged brain ventricles and coat color dilution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Vac14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Vac14 APN 8 110653607 splice site probably benign
IGL01511:Vac14 APN 8 110712798 missense possibly damaging 0.93
IGL01724:Vac14 APN 8 110618891 start codon destroyed probably null 1.00
IGL01784:Vac14 APN 8 110671168 missense probably benign 0.00
IGL02086:Vac14 APN 8 110653318 missense possibly damaging 0.74
IGL02447:Vac14 APN 8 110653628 missense probably benign 0.39
IGL02614:Vac14 APN 8 110635118 missense probably damaging 1.00
IGL03059:Vac14 APN 8 110710452 missense probably damaging 1.00
IGL03155:Vac14 APN 8 110636343 missense possibly damaging 0.90
ducky UTSW 8 110636472 splice site probably null
Rubber UTSW 8 110671042 missense probably damaging 1.00
R0045:Vac14 UTSW 8 110636952 missense probably benign 0.00
R0045:Vac14 UTSW 8 110636952 missense probably benign 0.00
R0239:Vac14 UTSW 8 110635375 critical splice acceptor site probably null
R0239:Vac14 UTSW 8 110635375 critical splice acceptor site probably null
R0718:Vac14 UTSW 8 110632477 missense probably damaging 1.00
R1696:Vac14 UTSW 8 110632447 critical splice acceptor site probably null
R1883:Vac14 UTSW 8 110711687 missense probably damaging 1.00
R1884:Vac14 UTSW 8 110711687 missense probably damaging 1.00
R1903:Vac14 UTSW 8 110682534 missense probably benign 0.04
R2764:Vac14 UTSW 8 110710455 missense probably damaging 1.00
R3000:Vac14 UTSW 8 110634317 missense probably damaging 1.00
R3498:Vac14 UTSW 8 110671090 missense probably benign
R4898:Vac14 UTSW 8 110645808 missense probably benign
R5030:Vac14 UTSW 8 110710386 missense possibly damaging 0.66
R5918:Vac14 UTSW 8 110636472 splice site probably null
R5930:Vac14 UTSW 8 110710349 missense probably damaging 1.00
R7003:Vac14 UTSW 8 110712798 missense probably damaging 0.99
R7092:Vac14 UTSW 8 110715496 missense probably damaging 1.00
R7214:Vac14 UTSW 8 110671042 missense probably damaging 1.00
R7327:Vac14 UTSW 8 110711620 missense probably damaging 1.00
R7474:Vac14 UTSW 8 110636434 missense probably damaging 1.00
R7741:Vac14 UTSW 8 110634388 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAATGCCGGTTCTCCAG -3'
(R):5'- ACAGGACGTGCAGTAAGACTAC -3'

Sequencing Primer
(F):5'- AGGGACCTCTCCTACCTGG -3'
(R):5'- CAGAGTGCTTTTCCAGACAAGGTC -3'
Posted On2016-07-06