Incidental Mutation 'R5255:Tarbp1'
ID399489
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 126428970 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1343 (D1343A)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059093] [ENSMUST00000170518] [ENSMUST00000211868]
Predicted Effect probably benign
Transcript: ENSMUST00000059093
SMART Domains Protein: ENSMUSP00000058279
Gene: ENSMUSG00000051671

DomainStartEndE-ValueType
Pfam:COX6B 1 67 6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170518
AA Change: D1343A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: D1343A

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211868
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R1873:Tarbp1 UTSW 8 126447047 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5638:Tarbp1 UTSW 8 126450686 missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 126452928 missense probably benign 0.05
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
R7760:Tarbp1 UTSW 8 126452807 missense not run
R7837:Tarbp1 UTSW 8 126474561 missense probably benign 0.00
R7882:Tarbp1 UTSW 8 126456493 missense probably damaging 1.00
R7965:Tarbp1 UTSW 8 126456493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTAAGTAGAGGCAGAGACCCAG -3'
(R):5'- AGCCTGCAAGTTGAGGATGG -3'

Sequencing Primer
(F):5'- CAGGTCAGTGAAACAAAGTCATC -3'
(R):5'- GCACTAGCATTAATAAAACCTGGG -3'
Posted On2016-07-06