Incidental Mutation 'R5178:Tcrg-C4'
ID399502
Institutional Source Beutler Lab
Gene Symbol Tcrg-C4
Ensembl Gene ENSMUSG00000076757
Gene NameT cell receptor gamma, constant 4
Synonyms
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location19344558-19352343 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 19344762 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103564] [ENSMUST00000184430]
Predicted Effect probably benign
Transcript: ENSMUST00000103564
SMART Domains Protein: ENSMUSP00000100342
Gene: ENSMUSG00000076755

DomainStartEndE-ValueType
IGv 34 113 8.44e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000179181
AA Change: Y68C
Predicted Effect probably benign
Transcript: ENSMUST00000184430
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Tcrg-C4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03328:Tcrg-C4 APN 13 19352246 missense unknown
R4633:Tcrg-C4 UTSW 13 19352287 missense probably benign 0.00
R5035:Tcrg-C4 UTSW 13 19352336 missense unknown
R5125:Tcrg-C4 UTSW 13 19344762 unclassified probably benign
R5556:Tcrg-C4 UTSW 13 19352307 missense unknown
R7006:Tcrg-C4 UTSW 13 19344825 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GACTCAGACTTTTCTCCCAAGC -3'
(R):5'- ACCTGTAACATTCTCGGGGAC -3'

Sequencing Primer
(F):5'- AAGCCTACTATTTTCCTTCCTTCTG -3'
(R):5'- CCTGTAACATTCTCGGGGACAGAAG -3'
Posted On2016-07-06