Incidental Mutation 'R5255:Slc16a11'
ID399503
Institutional Source Beutler Lab
Gene Symbol Slc16a11
Ensembl Gene ENSMUSG00000040938
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 11
SynonymsMNCb-2717
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70212752-70216417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70215432 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 165 (D165E)
Ref Sequence ENSEMBL: ENSMUSP00000128419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060010] [ENSMUST00000094055] [ENSMUST00000123716] [ENSMUST00000126296] [ENSMUST00000126388] [ENSMUST00000136328] [ENSMUST00000141290] [ENSMUST00000153993] [ENSMUST00000159867] [ENSMUST00000171032] [ENSMUST00000190533]
Predicted Effect probably benign
Transcript: ENSMUST00000060010
SMART Domains Protein: ENSMUSP00000053218
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
Pfam:MFS_1 14 277 1.7e-22 PFAM
Pfam:MFS_1 219 423 6.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094055
AA Change: D165E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091597
Gene: ENSMUSG00000040938
AA Change: D165E

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122852
Predicted Effect probably benign
Transcript: ENSMUST00000123716
SMART Domains Protein: ENSMUSP00000114871
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126296
AA Change: D165E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118381
Gene: ENSMUSG00000040938
AA Change: D165E

DomainStartEndE-ValueType
Pfam:MFS_1 16 196 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126388
AA Change: D165E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116648
Gene: ENSMUSG00000040938
AA Change: D165E

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131468
Predicted Effect probably damaging
Transcript: ENSMUST00000136328
AA Change: D117E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115212
Gene: ENSMUSG00000040938
AA Change: D117E

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 66 297 8.3e-10 PFAM
low complexity region 306 324 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141290
SMART Domains Protein: ENSMUSP00000116316
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149880
Predicted Effect probably benign
Transcript: ENSMUST00000153993
SMART Domains Protein: ENSMUSP00000122586
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159867
SMART Domains Protein: ENSMUSP00000124687
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171032
AA Change: D165E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128419
Gene: ENSMUSG00000040938
AA Change: D165E

DomainStartEndE-ValueType
Pfam:MFS_1 17 316 1.8e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190533
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Slc16a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Slc16a11 APN 11 70215416 missense probably damaging 0.99
shanxi UTSW 11 70215651 nonsense probably null
taihang UTSW 11 70215734 unclassified probably null
R0619:Slc16a11 UTSW 11 70215032 missense probably damaging 1.00
R2044:Slc16a11 UTSW 11 70215651 nonsense probably null
R2110:Slc16a11 UTSW 11 70215320 missense probably damaging 1.00
R4408:Slc16a11 UTSW 11 70215734 unclassified probably null
R4633:Slc16a11 UTSW 11 70216379 unclassified probably null
R5544:Slc16a11 UTSW 11 70215000 unclassified probably null
R5901:Slc16a11 UTSW 11 70216346 missense probably benign 0.02
R6116:Slc16a11 UTSW 11 70215436 missense probably benign 0.08
R6993:Slc16a11 UTSW 11 70216016 missense possibly damaging 0.60
R7658:Slc16a11 UTSW 11 70215317 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCCTATCCATTTGCAGGC -3'
(R):5'- GATCTAAAGCATGCGGACCC -3'

Sequencing Primer
(F):5'- ATCCATTTGCAGGCTCTGG -3'
(R):5'- TCTAAAGCATGCGGACCCAAATG -3'
Posted On2016-07-06