Incidental Mutation 'R5178:Abt1'
ID399504
Institutional Source Beutler Lab
Gene Symbol Abt1
Ensembl Gene ENSMUSG00000036376
Gene Nameactivator of basal transcription 1
Synonyms
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23418361-23423866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23422649 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 94 (A94E)
Ref Sequence ENSEMBL: ENSMUSP00000045888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041782
AA Change: A94E

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045888
Gene: ENSMUSG00000036376
AA Change: A94E

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
low complexity region 36 44 N/A INTRINSIC
Blast:RRM 49 141 9e-34 BLAST
SCOP:d1fxla1 50 137 4e-3 SMART
coiled coil region 166 194 N/A INTRINSIC
Meta Mutation Damage Score 0.1561 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Basal transcription of genes by RNA polymerase II requires the interaction of TATA-binding protein (TBP) with the core region of class II promoters. Studies in mouse suggest that the protein encoded by this gene likely activates basal transcription from class II promoters by interaction with TBP and the class II promoter DNA. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Abt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Abt1 APN 13 23423768 missense unknown
IGL01917:Abt1 APN 13 23423789 missense unknown
FR4548:Abt1 UTSW 13 23423711 small deletion probably benign
FR4976:Abt1 UTSW 13 23423711 small deletion probably benign
PIT4486001:Abt1 UTSW 13 23423681 missense possibly damaging 0.87
R0029:Abt1 UTSW 13 23422508 missense possibly damaging 0.85
R2171:Abt1 UTSW 13 23422217 missense probably damaging 1.00
R4082:Abt1 UTSW 13 23422146 missense probably benign 0.00
R5125:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5204:Abt1 UTSW 13 23422668 missense probably damaging 1.00
R5947:Abt1 UTSW 13 23422055 missense possibly damaging 0.55
R6562:Abt1 UTSW 13 23423588 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTCAGAGCTAGCAGGAAG -3'
(R):5'- AAGTTGTCATTTGAAGGGAGGC -3'

Sequencing Primer
(F):5'- TGCCTGGACTAGAGCTGGAG -3'
(R):5'- TCATTTGAAGGGAGGCATGAATTAAG -3'
Posted On2016-07-06