Incidental Mutation 'R5255:Slc16a5'
ID399509
Institutional Source Beutler Lab
Gene Symbol Slc16a5
Ensembl Gene ENSMUSG00000045775
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 5
SynonymsMCT5, A130015N09Rik
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115462474-115474398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115462675 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000102142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092445] [ENSMUST00000106532] [ENSMUST00000153466]
Predicted Effect probably benign
Transcript: ENSMUST00000092445
AA Change: T23A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090102
Gene: ENSMUSG00000045775
AA Change: T23A

DomainStartEndE-ValueType
Pfam:MFS_1 15 303 5.9e-31 PFAM
Pfam:MFS_1 302 459 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106532
AA Change: T23A

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102142
Gene: ENSMUSG00000045775
AA Change: T23A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146500
Predicted Effect probably benign
Transcript: ENSMUST00000153466
AA Change: T23A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117727
Gene: ENSMUSG00000045775
AA Change: T23A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the monocarboxylate transporter family and the major facilitator superfamily. The encoded protein is localized to the cell membrane and acts as a proton-linked transporter of bumetanide. Transport by the encoded protein is inhibited by four loop diuretics, nateglinide, thiazides, probenecid, and glibenclamide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Slc16a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Slc16a5 APN 11 115465001 missense probably benign
IGL02190:Slc16a5 APN 11 115462609 start codon destroyed probably null 1.00
IGL02852:Slc16a5 APN 11 115469579 missense probably benign 0.03
IGL02942:Slc16a5 APN 11 115469350 missense possibly damaging 0.50
R0090:Slc16a5 UTSW 11 115464925 missense probably damaging 1.00
R1928:Slc16a5 UTSW 11 115470016 missense probably damaging 0.98
R1930:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R1931:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R5548:Slc16a5 UTSW 11 115469804 missense probably benign 0.32
R5592:Slc16a5 UTSW 11 115472782 missense probably benign 0.05
R5770:Slc16a5 UTSW 11 115472778 missense possibly damaging 0.70
R8381:Slc16a5 UTSW 11 115469890 missense probably benign
Z1176:Slc16a5 UTSW 11 115469372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTTTCAGTCACCCAGGTG -3'
(R):5'- AAGTCAGGAAGATCACGCC -3'

Sequencing Primer
(F):5'- AGGTGGTGCGGCAGGTG -3'
(R):5'- GGAAGATCACGCCCTCCC -3'
Posted On2016-07-06