Mutagenetix > Incidental Mutations

Incidental Mutation 'R5178:Zfhx2'

399512

Institutional Source

Beutler Lab

Gene Symbol

Zfhx2

Ensembl Gene

ENSMUSG00000040721

Gene Name

zinc finger homeobox 2

Synonyms

zfh-5

MMRRC Submission

042758-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.460) question?

Stock #

R5178 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55060262-55092324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55074775 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 154 (F154Y)

Ref Sequence

ENSEMBL: ENSMUSP00000045156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]

Predicted Effect

probably benign
Transcript: ENSMUST00000036328
AA Change: F154Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: F154Y

Domain	Start	End	E-Value	Type
low complexity region	22	42	N/A	INTRINSIC
ZnF_C2H2	230	252	1.43e1	SMART
low complexity region	333	345	N/A	INTRINSIC
low complexity region	428	439	N/A	INTRINSIC
ZnF_C2H2	446	469	8.94e-3	SMART
ZnF_U1	498	532	6.98e-1	SMART
ZnF_C2H2	501	525	3.21e-4	SMART
ZnF_U1	560	594	1.36e0	SMART
ZnF_C2H2	563	587	3.29e-1	SMART
low complexity region	597	623	N/A	INTRINSIC
ZnF_C2H2	752	776	6.4e0	SMART
ZnF_C2H2	815	839	2.02e-1	SMART
ZnF_U1	861	895	1.78e1	SMART
ZnF_C2H2	864	888	5.34e-1	SMART
ZnF_C2H2	974	997	1.51e1	SMART
ZnF_C2H2	1003	1026	1.51e0	SMART
low complexity region	1087	1103	N/A	INTRINSIC
low complexity region	1106	1126	N/A	INTRINSIC
ZnF_U1	1182	1216	3.42e0	SMART
ZnF_C2H2	1185	1209	8.22e-2	SMART
ZnF_U1	1239	1273	3.73e0	SMART
ZnF_C2H2	1242	1266	6.67e-2	SMART
low complexity region	1277	1304	N/A	INTRINSIC
low complexity region	1314	1326	N/A	INTRINSIC
low complexity region	1332	1346	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
low complexity region	1379	1400	N/A	INTRINSIC
low complexity region	1457	1465	N/A	INTRINSIC
ZnF_C2H2	1474	1497	5.34e0	SMART
low complexity region	1522	1531	N/A	INTRINSIC
low complexity region	1542	1554	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
HOX	1589	1651	1.97e-16	SMART
low complexity region	1656	1665	N/A	INTRINSIC
coiled coil region	1693	1723	N/A	INTRINSIC
ZnF_C2H2	1761	1783	2.53e-2	SMART
low complexity region	1837	1847	N/A	INTRINSIC
HOX	1851	1913	2.34e-18	SMART
low complexity region	1984	1995	N/A	INTRINSIC
low complexity region	2001	2051	N/A	INTRINSIC
HOX	2058	2120	1.52e-17	SMART
ZnF_U1	2136	2170	1.09e1	SMART
ZnF_C2H2	2139	2163	5.4e1	SMART
low complexity region	2328	2354	N/A	INTRINSIC
low complexity region	2385	2426	N/A	INTRINSIC
ZnF_U1	2482	2516	8.31e-1	SMART
ZnF_C2H2	2485	2509	9.46e0	SMART
low complexity region	2523	2538	N/A	INTRINSIC
low complexity region	2553	2562	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176665

SMART Domains

Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

Domain	Start	End	E-Value	Type
ZnF_C2H2	13	37	5.34e-1	SMART
ZnF_C2H2	133	156	1.51e1	SMART
ZnF_C2H2	162	185	1.51e0	SMART
low complexity region	246	262	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
ZnF_C2H2	344	368	8.22e-2	SMART
ZnF_C2H2	401	425	6.67e-2	SMART
low complexity region	436	463	N/A	INTRINSIC
low complexity region	473	485	N/A	INTRINSIC
low complexity region	491	505	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
low complexity region	538	559	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183750

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183822

SMART Domains

Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

Domain	Start	End	E-Value	Type
PDB:2JMU\|A	5	64	3e-23	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185121

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185430

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abt1	G	T	13: 23,422,649	A94E	possibly damaging	Het
Carmil2	G	T	8: 105,696,889	G1207V	probably damaging	Het
Cndp2	A	T	18: 84,675,028	N202K	probably benign	Het
Cyp2c66	A	G	19: 39,171,029	Y308C	probably damaging	Het
Dhx29	T	G	13: 112,932,600	S155A	possibly damaging	Het
Dnah7b	T	G	1: 46,358,216	F3936V	possibly damaging	Het
Dsg1b	G	A	18: 20,397,503	G405E	probably damaging	Het
Exo5	A	T	4: 120,921,537		probably null	Het
Fam171b	T	C	2: 83,879,987	F668L	probably damaging	Het
Gemin5	A	T	11: 58,146,518	S624T	probably benign	Het
Gm15922	T	A	7: 3,739,397	K44*	probably null	Het
Gpc2	C	A	5: 138,275,605	V444L	possibly damaging	Het
Hephl1	T	A	9: 15,086,172	K399N	probably damaging	Het
Lair1	G	A	7: 4,010,489	T82I	possibly damaging	Het
Lhx1	G	T	11: 84,520,388	A155E	possibly damaging	Het
Maip1	G	A	1: 57,415,690	D278N	probably benign	Het
Mcm4	T	A	16: 15,635,303	D174V	probably benign	Het
Mcph1	T	A	8: 18,607,326	D60E	probably damaging	Het
Mmp17	T	A	5: 129,595,058	W132R	probably damaging	Het
Olfr1178	C	T	2: 88,391,475	T76I	possibly damaging	Het
Olfr868	T	A	9: 20,101,192	C144*	probably null	Het
Pds5a	T	C	5: 65,663,875	T169A	probably damaging	Het
Pfkm	A	G	15: 98,131,515	N697D	probably benign	Het
Ppwd1	A	T	13: 104,220,435	S191T	probably benign	Het
Ranbp2	T	A	10: 58,476,785	M1109K	probably benign	Het
Robo4	T	C	9: 37,407,960	W535R	probably damaging	Het
Rsf1	A	G	7: 97,661,872	D603G	possibly damaging	Het
Slc22a26	T	C	19: 7,790,175	T289A	possibly damaging	Het
Sp2	A	G	11: 96,955,838	F554L	probably benign	Het
Sp4	A	G	12: 118,261,889	V580A	possibly damaging	Het
Tbc1d19	T	A	5: 53,889,325	S413T	possibly damaging	Het
Tcrg-C4	A	G	13: 19,344,762		probably benign	Het
Tecta	T	C	9: 42,375,185	D725G	probably damaging	Het
Tmem200a	T	A	10: 25,994,379	Q4H	probably benign	Het
Tpx2	T	A	2: 152,875,549	I122N	probably benign	Het
Ube4b	T	C	4: 149,342,992	M900V	probably damaging	Het
Vmn1r87	G	T	7: 13,131,865	A165E	possibly damaging	Het
Vmn2r95	A	G	17: 18,440,075	T250A	probably benign	Het
Wasf1	G	A	10: 40,937,676	R518H	unknown	Het
Zfp729a	A	G	13: 67,637,645		probably null	Het
Zfp976	A	G	7: 42,612,501		probably null	Het

Other mutations in Zfhx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Zfhx2	APN	14	55066565	missense	possibly damaging	0.93
IGL00164:Zfhx2	APN	14	55065026	missense	possibly damaging	0.73
IGL00235:Zfhx2	APN	14	55063257	missense	probably benign	0.11
IGL00925:Zfhx2	APN	14	55073061	missense	probably benign	0.06
IGL01025:Zfhx2	APN	14	55064260	missense	probably damaging	1.00
IGL01061:Zfhx2	APN	14	55073882	missense	possibly damaging	0.96
IGL01486:Zfhx2	APN	14	55067090	missense	probably damaging	1.00
IGL01875:Zfhx2	APN	14	55063915	missense	unknown
IGL01990:Zfhx2	APN	14	55073590	missense	probably damaging	0.99
IGL02097:Zfhx2	APN	14	55062894	missense	probably damaging	1.00
IGL02269:Zfhx2	APN	14	55071936	missense	probably benign	0.00
IGL02488:Zfhx2	APN	14	55065103	missense	possibly damaging	0.72
IGL02624:Zfhx2	APN	14	55066628	missense	probably benign	0.06
IGL03087:Zfhx2	APN	14	55072845	missense	possibly damaging	0.85
G1patch:Zfhx2	UTSW	14	55064082	nonsense	probably null
PIT4403001:Zfhx2	UTSW	14	55074980	missense	probably benign
R0148:Zfhx2	UTSW	14	55072897	missense	possibly damaging	0.86
R0323:Zfhx2	UTSW	14	55065979	missense	possibly damaging	0.73
R0328:Zfhx2	UTSW	14	55071988	missense	probably benign
R0348:Zfhx2	UTSW	14	55063508	missense	probably damaging	0.99
R0442:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R0533:Zfhx2	UTSW	14	55064090	missense	probably benign	0.23
R0561:Zfhx2	UTSW	14	55065889	missense	probably benign	0.01
R0627:Zfhx2	UTSW	14	55065327	missense	probably benign
R0659:Zfhx2	UTSW	14	55073801	missense	possibly damaging	0.73
R0675:Zfhx2	UTSW	14	55063163	missense	probably damaging	0.99
R1301:Zfhx2	UTSW	14	55063397	missense	probably benign	0.32
R1563:Zfhx2	UTSW	14	55065088	missense	probably benign	0.33
R1607:Zfhx2	UTSW	14	55062985	missense	probably damaging	1.00
R1694:Zfhx2	UTSW	14	55073944	missense	possibly damaging	0.91
R1710:Zfhx2	UTSW	14	55065998	missense	possibly damaging	0.70
R1773:Zfhx2	UTSW	14	55072891	missense	possibly damaging	0.53
R1879:Zfhx2	UTSW	14	55065617	missense	probably benign	0.32
R1879:Zfhx2	UTSW	14	55072749	missense	possibly damaging	0.96
R1933:Zfhx2	UTSW	14	55075238	start gained	probably benign
R1944:Zfhx2	UTSW	14	55074732	missense	probably benign	0.18
R2888:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2889:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2915:Zfhx2	UTSW	14	55064557	missense	probably damaging	0.98
R3971:Zfhx2	UTSW	14	55074475	missense	probably benign	0.33
R4082:Zfhx2	UTSW	14	55065205	missense	probably benign
R4134:Zfhx2	UTSW	14	55065143	missense	possibly damaging	0.93
R4231:Zfhx2	UTSW	14	55073534	missense	possibly damaging	0.73
R4675:Zfhx2	UTSW	14	55067221	missense	probably benign	0.03
R4764:Zfhx2	UTSW	14	55066915	missense	possibly damaging	0.96
R4866:Zfhx2	UTSW	14	55065536	missense	possibly damaging	0.73
R4940:Zfhx2	UTSW	14	55066434	missense	possibly damaging	0.53
R5125:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5554:Zfhx2	UTSW	14	55064317	missense	probably damaging	1.00
R5689:Zfhx2	UTSW	14	55073903	missense	possibly damaging	0.53
R5768:Zfhx2	UTSW	14	55074365	missense	probably benign
R5792:Zfhx2	UTSW	14	55066846	missense	possibly damaging	0.72
R5834:Zfhx2	UTSW	14	55073330	nonsense	probably null
R5895:Zfhx2	UTSW	14	55065891	missense	probably benign
R5999:Zfhx2	UTSW	14	55074005	missense	probably benign
R6025:Zfhx2	UTSW	14	55065208	missense	probably benign	0.00
R6106:Zfhx2	UTSW	14	55068310	critical splice acceptor site	probably null
R6135:Zfhx2	UTSW	14	55074196	missense	possibly damaging	0.85
R6186:Zfhx2	UTSW	14	55063160	missense	probably damaging	0.99
R6379:Zfhx2	UTSW	14	55074338	missense	probably benign
R6725:Zfhx2	UTSW	14	55064082	nonsense	probably null
R7089:Zfhx2	UTSW	14	55065772	missense	probably benign	0.33
R7383:Zfhx2	UTSW	14	55068253	missense	probably benign	0.00
R7470:Zfhx2	UTSW	14	55066750	missense	possibly damaging	0.52
R7606:Zfhx2	UTSW	14	55066663	missense	probably benign	0.12
R7607:Zfhx2	UTSW	14	55066231	missense	possibly damaging	0.86
R7698:Zfhx2	UTSW	14	55062849	missense	probably benign	0.00
R7730:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R8142:Zfhx2	UTSW	14	55073438	missense	possibly damaging	0.86
R8188:Zfhx2	UTSW	14	55064441	missense	probably benign	0.18
R8212:Zfhx2	UTSW	14	55072916	missense	possibly damaging	0.70
R8264:Zfhx2	UTSW	14	55065512	missense	possibly damaging	0.53
R8331:Zfhx2	UTSW	14	55071987	missense	probably benign	0.00
R8369:Zfhx2	UTSW	14	55066744	missense	probably benign	0.05
R8371:Zfhx2	UTSW	14	55064092	missense	probably damaging	0.99
R8383:Zfhx2	UTSW	14	55074071	missense	possibly damaging	0.73
R8415:Zfhx2	UTSW	14	55070622	missense	probably benign
R8441:Zfhx2	UTSW	14	55066528	missense	possibly damaging	0.96
R8466:Zfhx2	UTSW	14	55072896	missense	possibly damaging	0.53
R8504:Zfhx2	UTSW	14	55065786	missense	probably benign	0.00
X0065:Zfhx2	UTSW	14	55066960	missense	probably benign	0.33
Z1088:Zfhx2	UTSW	14	55074180	missense	possibly damaging	0.73
Z1177:Zfhx2	UTSW	14	55065920	missense	probably benign	0.40
Z1177:Zfhx2	UTSW	14	55066982	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- AGATCCAAAACATCGCCCTGTG -3'
(R):5'- CTTCCTTTGGACCTCAGCAG -3'

Sequencing Primer
(F):5'- AAAACATCGCCCTGTGGTCTTC -3'
(R):5'- AGCAGCCACTTATTCTTCGCAG -3'

Posted On

2016-07-06