Incidental Mutation 'R5255:Akr1c6'
ID399513
Institutional Source Beutler Lab
Gene Symbol Akr1c6
Ensembl Gene ENSMUSG00000021210
Gene Namealdo-keto reductase family 1, member C6
Synonyms3alpha-HSD, estradiol 17-beta-dehydrogenase (A-specific), Hsd17b5, Akr1c1
MMRRC Submission 042826-MU
Accession Numbers

Genbank: NM_030611; MGI: 1933427

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location4434306-4457877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4447019 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 153 (K153N)
Ref Sequence ENSEMBL: ENSMUSP00000021630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021630] [ENSMUST00000156277] [ENSMUST00000220941] [ENSMUST00000223118]
Predicted Effect probably benign
Transcript: ENSMUST00000021630
AA Change: K153N

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021630
Gene: ENSMUSG00000021210
AA Change: K153N

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156277
AA Change: K100N

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117624
Gene: ENSMUSG00000021210
AA Change: K100N

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 173 3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220941
Predicted Effect probably benign
Transcript: ENSMUST00000223118
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Akr1c6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Akr1c6 APN 13 4448978 splice site probably benign
IGL01838:Akr1c6 APN 13 4449036 missense probably benign 0.44
IGL02318:Akr1c6 APN 13 4438497 missense probably benign 0.05
IGL02986:Akr1c6 APN 13 4436415 missense probably benign 0.42
IGL03168:Akr1c6 APN 13 4436281 missense probably benign 0.04
IGL03190:Akr1c6 APN 13 4446413 missense possibly damaging 0.49
IGL03258:Akr1c6 APN 13 4436409 missense probably damaging 1.00
R0940:Akr1c6 UTSW 13 4436373 missense probably benign 0.42
R1442:Akr1c6 UTSW 13 4457160 missense probably damaging 1.00
R1624:Akr1c6 UTSW 13 4446364 missense probably benign
R1937:Akr1c6 UTSW 13 4446384 missense probably benign 0.01
R2392:Akr1c6 UTSW 13 4434478 splice site probably null
R2398:Akr1c6 UTSW 13 4449036 missense probably benign 0.44
R4655:Akr1c6 UTSW 13 4449429 missense probably damaging 0.98
R4761:Akr1c6 UTSW 13 4447011 missense probably benign 0.01
R4913:Akr1c6 UTSW 13 4454525 missense probably benign 0.18
R4923:Akr1c6 UTSW 13 4454495 missense probably damaging 1.00
R4953:Akr1c6 UTSW 13 4438609 splice site probably null
R5452:Akr1c6 UTSW 13 4454545 missense probably benign 0.00
R5660:Akr1c6 UTSW 13 4449054 missense probably benign 0.13
R6242:Akr1c6 UTSW 13 4436362 missense probably benign 0.01
R6323:Akr1c6 UTSW 13 4447018 missense possibly damaging 0.91
R6599:Akr1c6 UTSW 13 4449319 unclassified probably null
R6847:Akr1c6 UTSW 13 4438498 nonsense probably null
R6989:Akr1c6 UTSW 13 4449046 missense probably damaging 1.00
R7003:Akr1c6 UTSW 13 4454515 missense probably benign 0.14
R7251:Akr1c6 UTSW 13 4447020 missense probably damaging 1.00
R7310:Akr1c6 UTSW 13 4436355 missense probably benign
X0062:Akr1c6 UTSW 13 4438535 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTAGGGATCGCTCAGGGTC -3'
(R):5'- TCTGTCAGCTGCAGAGGAAG -3'

Sequencing Primer
(F):5'- ATCTGCATGGAGATGTTAGATCCC -3'
(R):5'- TGTCAGCTGCAGAGGAAGAAAGG -3'
Posted On2016-07-06