Incidental Mutation 'R5178:Pfkm'
ID399514
Institutional Source Beutler Lab
Gene Symbol Pfkm
Ensembl Gene ENSMUSG00000033065
Gene Namephosphofructokinase, muscle
SynonymsPFK-M, Pfk-4, PFK-A, Pfk4, Pfkx
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98092589-98132451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98131515 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 697 (N697D)
Ref Sequence ENSEMBL: ENSMUSP00000155809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051226] [ENSMUST00000059112] [ENSMUST00000123626] [ENSMUST00000123922] [ENSMUST00000143400] [ENSMUST00000163507] [ENSMUST00000230445]
Predicted Effect probably benign
Transcript: ENSMUST00000051226
AA Change: N697D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059801
Gene: ENSMUSG00000033065
AA Change: N697D

DomainStartEndE-ValueType
Pfam:PFK 17 324 1.3e-111 PFAM
Pfam:PFK 402 687 1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059112
SMART Domains Protein: ENSMUSP00000057864
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123626
SMART Domains Protein: ENSMUSP00000121383
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123922
SMART Domains Protein: ENSMUSP00000119481
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143400
SMART Domains Protein: ENSMUSP00000115813
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163507
AA Change: N697D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132803
Gene: ENSMUSG00000033065
AA Change: N697D

DomainStartEndE-ValueType
Pfam:PFK 16 326 2.9e-138 PFAM
Pfam:PFK 401 688 1.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230445
AA Change: N697D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal glucose homeostasis. Mice homozygous for a knock-out allele exhibit premature death, exercise intolerance, abnormal glucose homeostasis, cardiomegaly, splenomegaly, and abnormal muscle morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Pfkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Pfkm APN 15 98125594 missense probably benign 0.00
IGL01843:Pfkm APN 15 98129306 missense possibly damaging 0.65
IGL02090:Pfkm APN 15 98123240 critical splice donor site probably null
IGL02624:Pfkm APN 15 98126395 missense probably benign 0.03
IGL02869:Pfkm APN 15 98128242 missense probably damaging 1.00
IGL03102:Pfkm APN 15 98126385 missense possibly damaging 0.86
IGL03164:Pfkm APN 15 98131962 missense probably damaging 1.00
IGL03188:Pfkm APN 15 98123243 splice site probably null
IGL03241:Pfkm APN 15 98123180 missense probably benign 0.02
E0374:Pfkm UTSW 15 98123233 missense probably damaging 1.00
R0379:Pfkm UTSW 15 98126314 missense probably benign 0.01
R0524:Pfkm UTSW 15 98131607 missense probably benign
R0898:Pfkm UTSW 15 98128230 missense probably benign 0.09
R1086:Pfkm UTSW 15 98131665 missense probably benign 0.05
R1698:Pfkm UTSW 15 98128318 missense possibly damaging 0.95
R1886:Pfkm UTSW 15 98127746 missense probably damaging 1.00
R2051:Pfkm UTSW 15 98131692 missense probably benign 0.03
R2102:Pfkm UTSW 15 98129290 missense probably damaging 1.00
R2312:Pfkm UTSW 15 98125575 missense probably damaging 1.00
R3154:Pfkm UTSW 15 98118209 missense probably damaging 1.00
R3688:Pfkm UTSW 15 98131517 missense probably benign 0.00
R3911:Pfkm UTSW 15 98125047 missense probably benign 0.02
R4999:Pfkm UTSW 15 98128242 missense probably damaging 1.00
R5008:Pfkm UTSW 15 98122689 missense probably benign 0.35
R5027:Pfkm UTSW 15 98119426 missense possibly damaging 0.55
R5617:Pfkm UTSW 15 98122226 missense possibly damaging 0.88
R5891:Pfkm UTSW 15 98122690 nonsense probably null
R6248:Pfkm UTSW 15 98126379 missense probably damaging 1.00
R7079:Pfkm UTSW 15 98095082 missense probably benign 0.31
R7605:Pfkm UTSW 15 98121310 missense probably damaging 1.00
RF010:Pfkm UTSW 15 98129793 missense possibly damaging 0.78
X0020:Pfkm UTSW 15 98112226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGACTTCCGTCCTGTAAAC -3'
(R):5'- TCACTCAAAGTCTGTCTGGTCC -3'

Sequencing Primer
(F):5'- TTCCGTCCTGTAAACCCAAGG -3'
(R):5'- AAAGTCTGTCTGGTCCTTCAG -3'
Posted On2016-07-06