Incidental Mutation 'R5178:Mcm4'
ID399516
Institutional Source Beutler Lab
Gene Symbol Mcm4
Ensembl Gene ENSMUSG00000022673
Gene Nameminichromosome maintenance complex component 4
SynonymsmCdc21, 19G, Cdc21, Mcmd4
MMRRC Submission 042758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5178 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location15623897-15637400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15635303 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 174 (D174V)
Ref Sequence ENSEMBL: ENSMUSP00000023353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023352] [ENSMUST00000023353]
Predicted Effect probably benign
Transcript: ENSMUST00000023352
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023353
AA Change: D174V

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: D174V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
MCM 266 769 N/A SMART
AAA 501 653 7.04e-3 SMART
Blast:MCM 781 849 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182134
Predicted Effect unknown
Transcript: ENSMUST00000229606
AA Change: D1V
Predicted Effect unknown
Transcript: ENSMUST00000230437
AA Change: D66V
Meta Mutation Damage Score 0.4215 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cndp2 A T 18: 84,675,028 N202K probably benign Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dnah7b T G 1: 46,358,216 F3936V possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Fam171b T C 2: 83,879,987 F668L probably damaging Het
Gemin5 A T 11: 58,146,518 S624T probably benign Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gpc2 C A 5: 138,275,605 V444L possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lhx1 G T 11: 84,520,388 A155E possibly damaging Het
Maip1 G A 1: 57,415,690 D278N probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Mmp17 T A 5: 129,595,058 W132R probably damaging Het
Olfr1178 C T 2: 88,391,475 T76I possibly damaging Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
Pds5a T C 5: 65,663,875 T169A probably damaging Het
Pfkm A G 15: 98,131,515 N697D probably benign Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Ranbp2 T A 10: 58,476,785 M1109K probably benign Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Sp4 A G 12: 118,261,889 V580A possibly damaging Het
Tbc1d19 T A 5: 53,889,325 S413T possibly damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Tmem200a T A 10: 25,994,379 Q4H probably benign Het
Tpx2 T A 2: 152,875,549 I122N probably benign Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Vmn2r95 A G 17: 18,440,075 T250A probably benign Het
Wasf1 G A 10: 40,937,676 R518H unknown Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Other mutations in Mcm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Mcm4 APN 16 15626131 missense probably damaging 1.00
IGL01982:Mcm4 APN 16 15630420 missense possibly damaging 0.57
IGL02382:Mcm4 APN 16 15624738 missense probably damaging 1.00
PIT4687001:Mcm4 UTSW 16 15636713 missense probably benign 0.01
R0200:Mcm4 UTSW 16 15629639 missense probably benign 0.41
R0540:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R0607:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R2064:Mcm4 UTSW 16 15634469 missense possibly damaging 0.75
R4240:Mcm4 UTSW 16 15627706 nonsense probably null
R4604:Mcm4 UTSW 16 15629663 missense probably damaging 1.00
R4871:Mcm4 UTSW 16 15634510 nonsense probably null
R5070:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R5125:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5245:Mcm4 UTSW 16 15630425 missense probably benign 0.02
R5513:Mcm4 UTSW 16 15630514 missense probably benign 0.26
R5696:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R6453:Mcm4 UTSW 16 15630409 missense probably damaging 1.00
R6753:Mcm4 UTSW 16 15629362 missense possibly damaging 0.91
R6909:Mcm4 UTSW 16 15628697 missense probably damaging 1.00
R6937:Mcm4 UTSW 16 15636335 missense probably benign
R7402:Mcm4 UTSW 16 15637178 start codon destroyed probably null
R7483:Mcm4 UTSW 16 15630442 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTATGTGTTCGCAGTTCACATTT -3'
(R):5'- TTGTCACATATTTATTGCTGGGG -3'

Sequencing Primer
(F):5'- CTGTAAGACATATGGACAAGTC -3'
(R):5'- GCCCTTCACAGCTTTTATTTGGAGG -3'
Posted On2016-07-06