Incidental Mutation 'R5255:Btn1a1'
ID399517
Institutional Source Beutler Lab
Gene Symbol Btn1a1
Ensembl Gene ENSMUSG00000000706
Gene Namebutyrophilin, subfamily 1, member A1
SynonymsBtn
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23456992-23465901 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 23464154 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041674] [ENSMUST00000110434]
Predicted Effect probably benign
Transcript: ENSMUST00000041674
SMART Domains Protein: ENSMUSP00000041013
Gene: ENSMUSG00000000706

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
IG_like 150 237 9.03e1 SMART
transmembrane domain 246 268 N/A INTRINSIC
PRY 303 355 2.64e-27 SMART
SPRY 356 477 1.46e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000110434
AA Change: S170P
SMART Domains Protein: ENSMUSP00000106064
Gene: ENSMUSG00000000706
AA Change: S170P

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225831
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. It is a member of the immunoglobulin superfamily. It may have a cell surface receptor function. The human butyrophilin gene is localized in the major histocompatibility complex (MHC) class I region of 6p and may have arisen relatively recently in evolution by the shuffling of exons between 2 ancestral gene families [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired lactation and abnormal lipid accumulation in the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Btn1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Btn1a1 APN 13 23461737 missense possibly damaging 0.56
IGL01608:Btn1a1 APN 13 23461608 missense probably benign 0.00
IGL02538:Btn1a1 APN 13 23459215 missense possibly damaging 0.50
IGL02795:Btn1a1 APN 13 23460616 critical splice acceptor site probably null
IGL02933:Btn1a1 APN 13 23460527 missense possibly damaging 0.63
R0063:Btn1a1 UTSW 13 23465097 splice site probably null
R0855:Btn1a1 UTSW 13 23464319 missense probably damaging 1.00
R1754:Btn1a1 UTSW 13 23460468 missense probably benign 0.01
R2122:Btn1a1 UTSW 13 23461521 missense probably damaging 1.00
R3110:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3112:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3941:Btn1a1 UTSW 13 23459264 missense probably benign 0.01
R4169:Btn1a1 UTSW 13 23465155 missense probably benign
R4924:Btn1a1 UTSW 13 23464226 splice site probably benign
R4927:Btn1a1 UTSW 13 23460624 splice site probably null
R5554:Btn1a1 UTSW 13 23459125 missense possibly damaging 0.55
R5726:Btn1a1 UTSW 13 23459352 missense probably damaging 1.00
R6228:Btn1a1 UTSW 13 23464351 missense probably damaging 0.98
R6664:Btn1a1 UTSW 13 23459320 missense probably benign 0.00
R7117:Btn1a1 UTSW 13 23459245 missense possibly damaging 0.91
R7150:Btn1a1 UTSW 13 23459351 missense probably damaging 1.00
R7151:Btn1a1 UTSW 13 23459313 missense probably damaging 1.00
R7396:Btn1a1 UTSW 13 23461498 missense probably benign 0.01
R7504:Btn1a1 UTSW 13 23461716 missense probably benign 0.10
R7874:Btn1a1 UTSW 13 23459215 missense possibly damaging 0.50
R7878:Btn1a1 UTSW 13 23459044 missense possibly damaging 0.86
R7957:Btn1a1 UTSW 13 23459215 missense possibly damaging 0.50
R7961:Btn1a1 UTSW 13 23459044 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGATTTGGATCACTAACAGGGAGG -3'
(R):5'- ATCCGAGATGTCAGGGTCTCAG -3'

Sequencing Primer
(F):5'- TCCTTATGATCTCAGACAGGGAG -3'
(R):5'- TCTCAGACCAGGGGGAGTAC -3'
Posted On2016-07-06