Mutagenetix > Incidental Mutation

Incidental Mutation 'R5255:Slitrk6'

399522

Institutional Source

Beutler Lab

Gene Symbol

Slitrk6

Ensembl Gene

ENSMUSG00000045871

Gene Name

SLIT and NTRK-like family, member 6

Synonyms

4832410J21Rik

MMRRC Submission

042826-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R5255 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110748580-110755149 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to T at 110749753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Lysine at position 841 (*841K)

Ref Sequence

ENSEMBL: ENSMUSP00000077492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078386]

AlphaFold

Q8C110

Predicted Effect

probably null
Transcript: ENSMUST00000078386
AA Change: *841K

SMART Domains

Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: *841K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:LRRNT	30	68	4e-15	BLAST
LRR	87	110	1.71e1	SMART
LRR	111	134	3.07e-1	SMART
LRR	135	158	4.44e0	SMART
LRR_TYP	159	182	2.09e-3	SMART
LRR	185	206	6.23e1	SMART
LRRCT	218	268	5.61e-5	SMART
low complexity region	287	301	N/A	INTRINSIC
Blast:LRRNT	327	364	2e-17	BLAST
LRR	388	408	2.68e1	SMART
LRR_TYP	409	432	3.63e-3	SMART
LRR_TYP	433	456	6.23e-2	SMART
LRR_TYP	457	480	3.69e-4	SMART
low complexity region	501	513	N/A	INTRINSIC
LRRCT	516	566	1.53e-6	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	634	642	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	T	17: 33,066,765	C354*	probably null	Het
Abcf1	A	T	17: 35,959,737		probably null	Het
Abr	T	A	11: 76,455,683	E434V	probably damaging	Het
Acaca	T	A	11: 84,311,307	L197Q	probably damaging	Het
Acot10	A	G	15: 20,665,932	I241T	probably benign	Het
Acp6	T	C	3: 97,167,996	V182A	probably benign	Het
Ahnak2	G	A	12: 112,773,378	T1420I	possibly damaging	Het
Akr1c6	A	T	13: 4,447,019	K153N	probably benign	Het
Ank3	T	C	10: 69,885,200	L600P	probably damaging	Het
Arhgef1	G	A	7: 24,925,022	A824T	probably damaging	Het
B230307C23Rik	T	A	16: 98,008,691	N22K	possibly damaging	Het
Btn1a1	A	G	13: 23,464,154		probably benign	Het
Cenpf	G	A	1: 189,672,627	T352I	possibly damaging	Het
Ces4a	C	A	8: 105,142,489	F185L	probably benign	Het
Clybl	A	C	14: 122,384,279	E293A	probably benign	Het
Cobl	A	G	11: 12,375,825	W217R	probably damaging	Het
D430041D05Rik	T	C	2: 104,256,600	N677S	probably benign	Het
Ddx51	C	A	5: 110,656,042	T390N	possibly damaging	Het
Drd5	T	G	5: 38,319,967	V101G	probably damaging	Het
Elmo3	C	T	8: 105,307,353	P244L	probably benign	Het
Esrrg	G	A	1: 188,146,358	R189H	probably damaging	Het
Fxr2	A	G	11: 69,643,841	T183A	probably benign	Het
Gjd4	T	C	18: 9,280,613	H155R	probably benign	Het
Hivep2	T	A	10: 14,131,267		probably null	Het
Ints10	T	C	8: 68,793,972		probably benign	Het
Kank4	T	C	4: 98,778,972	T413A	probably benign	Het
Mapkbp1	T	C	2: 120,017,254	V568A	probably damaging	Het
Mobp	A	G	9: 120,168,353		probably benign	Het
Mpst	A	G	15: 78,410,508	S147G	probably benign	Het
Myo5b	A	T	18: 74,662,670	Y559F	possibly damaging	Het
Nceh1	T	C	3: 27,183,139	I21T	probably damaging	Het
Olfr1303	T	C	2: 111,814,178	K183E	probably benign	Het
Ralgps1	A	T	2: 33,276,159	V126E	probably damaging	Het
Rnls	A	G	19: 33,382,423	V115A	probably damaging	Het
Scn1a	A	T	2: 66,277,669	V1554D	probably damaging	Het
Slc16a11	T	A	11: 70,215,432	D165E	probably damaging	Het
Slc16a5	A	G	11: 115,462,675	T23A	probably benign	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc3a1	A	T	17: 85,028,453		probably null	Het
Syngr1	A	G	15: 80,091,446	Y18C	possibly damaging	Het
Tarbp1	T	G	8: 126,428,970	D1343A	probably benign	Het
Vac14	T	A	8: 110,634,329	I177N	probably damaging	Het
Vmn1r218	A	T	13: 23,136,711	D76V	possibly damaging	Het
Wdr75	T	A	1: 45,799,117	I62N	probably damaging	Het
Zfp12	A	T	5: 143,240,379	I68L	probably null	Het
Zswim8	T	A	14: 20,721,651	Y1551N	probably damaging	Het

Other mutations in Slitrk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Slitrk6	APN	14	110751115	missense	probably benign	0.35
IGL01131:Slitrk6	APN	14	110751576	missense	probably damaging	1.00
IGL01294:Slitrk6	APN	14	110750074	missense	probably benign
IGL01295:Slitrk6	APN	14	110751436	missense	possibly damaging	0.50
IGL01762:Slitrk6	APN	14	110751624	missense	probably damaging	1.00
IGL02165:Slitrk6	APN	14	110751817	missense	probably benign	0.41
IGL02546:Slitrk6	APN	14	110749794	missense	probably benign	0.18
IGL03103:Slitrk6	APN	14	110749941	missense	probably benign
PIT1430001:Slitrk6	UTSW	14	110750427	missense	possibly damaging	0.93
PIT4480001:Slitrk6	UTSW	14	110749825	frame shift	probably null
R0035:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0066:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0067:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0069:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0107:Slitrk6	UTSW	14	110751963	missense	possibly damaging	0.69
R0157:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110752293	start gained	probably benign
R0454:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0505:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0633:Slitrk6	UTSW	14	110751885	missense	probably damaging	1.00
R0711:Slitrk6	UTSW	14	110749819	missense	probably damaging	1.00
R0843:Slitrk6	UTSW	14	110750098	missense	probably benign
R1298:Slitrk6	UTSW	14	110751865	missense	possibly damaging	0.94
R1693:Slitrk6	UTSW	14	110750928	missense	probably damaging	1.00
R1756:Slitrk6	UTSW	14	110750552	missense	probably benign
R1998:Slitrk6	UTSW	14	110751823	missense	probably damaging	0.99
R2049:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2140:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2142:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2314:Slitrk6	UTSW	14	110751955	missense	probably damaging	1.00
R2566:Slitrk6	UTSW	14	110750272	missense	probably benign	0.00
R4231:Slitrk6	UTSW	14	110751388	missense	probably benign	0.02
R4236:Slitrk6	UTSW	14	110750148	missense	probably benign	0.07
R4247:Slitrk6	UTSW	14	110750739	missense	probably damaging	1.00
R4576:Slitrk6	UTSW	14	110750170	missense	probably benign	0.05
R4856:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4858:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4859:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4886:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4931:Slitrk6	UTSW	14	110750379	missense	probably damaging	1.00
R5281:Slitrk6	UTSW	14	110750373	missense	probably damaging	1.00
R5450:Slitrk6	UTSW	14	110750097	missense	probably benign
R5579:Slitrk6	UTSW	14	110751217	missense	possibly damaging	0.82
R5689:Slitrk6	UTSW	14	110752126	missense	probably benign
R5935:Slitrk6	UTSW	14	110749873	missense	probably benign	0.00
R6016:Slitrk6	UTSW	14	110750526	missense	probably benign	0.00
R6312:Slitrk6	UTSW	14	110750247	missense	probably benign	0.00
R6890:Slitrk6	UTSW	14	110751096	nonsense	probably null
R6952:Slitrk6	UTSW	14	110750542	missense	probably benign
R7378:Slitrk6	UTSW	14	110749863	missense	probably damaging	1.00
R8354:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8401:Slitrk6	UTSW	14	110752021	missense	possibly damaging	0.67
R8454:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8807:Slitrk6	UTSW	14	110750691	missense	possibly damaging	0.77
R8814:Slitrk6	UTSW	14	110749938	missense	probably benign
R8826:Slitrk6	UTSW	14	110751369	missense	probably benign
R9681:Slitrk6	UTSW	14	110750826	missense	probably damaging	1.00
R9740:Slitrk6	UTSW	14	110749998	missense	probably damaging	0.99
R9740:Slitrk6	UTSW	14	110750012	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ATGATAATGCCATGGCTTCCTC -3'
(R):5'- AACTTGGCATCACAGAGTACC -3'

Sequencing Primer
(F):5'- GATAATGCCATGGCTTCCTCAATTG -3'
(R):5'- AATCTTGCTCAGCTCCAGCCAG -3'

Posted On

2016-07-06