Incidental Mutation 'R5255:Mpst'
ID399527
Institutional Source Beutler Lab
Gene Symbol Mpst
Ensembl Gene ENSMUSG00000071711
Gene Namemercaptopyruvate sulfurtransferase
Synonyms
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78406416-78414013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78410508 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 147 (S147G)
Ref Sequence ENSEMBL: ENSMUSP00000155399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043865] [ENSMUST00000058659] [ENSMUST00000167140] [ENSMUST00000169133] [ENSMUST00000229739] [ENSMUST00000229791] [ENSMUST00000231159]
Predicted Effect probably benign
Transcript: ENSMUST00000043865
AA Change: S147G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043061
Gene: ENSMUSG00000071711
AA Change: S147G

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058659
SMART Domains Protein: ENSMUSP00000055743
Gene: ENSMUSG00000044986

DomainStartEndE-ValueType
RHOD 11 140 2.88e-18 SMART
RHOD 163 285 1.48e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167140
AA Change: S147G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130493
Gene: ENSMUSG00000071711
AA Change: S147G

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169133
AA Change: S147G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128075
Gene: ENSMUSG00000071711
AA Change: S147G

DomainStartEndE-ValueType
RHOD 11 141 1.36e-19 SMART
RHOD 164 285 1.11e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229739
AA Change: S147G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229791
Predicted Effect probably benign
Transcript: ENSMUST00000231159
AA Change: S147G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231525
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit reduced male fertility. Mice homozygous for a knock-out allele exhibit normal fertility but increased anxiety-related behaviors and increased serotonin metabolite levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Mpst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Mpst APN 15 78410274 missense probably benign 0.05
IGL02353:Mpst APN 15 78410085 missense probably damaging 1.00
IGL02360:Mpst APN 15 78410085 missense probably damaging 1.00
IGL03037:Mpst APN 15 78410598 missense probably benign 0.00
R3619:Mpst UTSW 15 78410122 missense probably damaging 0.99
R5256:Mpst UTSW 15 78413649 missense probably damaging 0.99
R7473:Mpst UTSW 15 78413526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCGATCGTTGCAGTGACC -3'
(R):5'- ATTAGTCCGTTTCCCCAGCG -3'

Sequencing Primer
(F):5'- ACGCACTTTGCCGACTACG -3'
(R):5'- AGCGCGTTACCATCTCG -3'
Posted On2016-07-06