Incidental Mutation 'R5255:Syngr1'
ID399528
Institutional Source Beutler Lab
Gene Symbol Syngr1
Ensembl Gene ENSMUSG00000022415
Gene Namesynaptogyrin 1
Synonymsp29, Syngr1b
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5255 (G1)
Quality Score196
Status Not validated
Chromosome15
Chromosomal Location80091334-80119501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80091446 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 18 (Y18C)
Ref Sequence ENSEMBL: ENSMUSP00000009728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009727] [ENSMUST00000009728] [ENSMUST00000185306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009727
AA Change: Y18C

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009727
Gene: ENSMUSG00000022415
AA Change: Y18C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:MARVEL 20 167 6e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000009728
AA Change: Y18C

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009728
Gene: ENSMUSG00000022415
AA Change: Y18C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:MARVEL 20 167 1.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082950
Predicted Effect probably benign
Transcript: ENSMUST00000185306
SMART Domains Protein: ENSMUSP00000140228
Gene: ENSMUSG00000060036

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 71 188 6.1e-41 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein associated with presynaptic vesicles in neuronal cells. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it functions in synaptic plasticity without being required for synaptic transmission. The gene product belongs to the synaptogyrin gene family. Three alternatively spliced variants encoding three different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a moderate decrease in post-tetanic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Syngr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2092:Syngr1 UTSW 15 80115940 missense possibly damaging 0.93
R2508:Syngr1 UTSW 15 80111740 missense probably damaging 1.00
R3887:Syngr1 UTSW 15 80116039 missense probably damaging 0.99
R5091:Syngr1 UTSW 15 80115885 missense probably damaging 1.00
R5271:Syngr1 UTSW 15 80098039 missense probably benign 0.01
R5440:Syngr1 UTSW 15 80098018 missense probably benign
R6369:Syngr1 UTSW 15 80115590 unclassified probably benign
R6596:Syngr1 UTSW 15 80111692 missense probably damaging 0.98
R7216:Syngr1 UTSW 15 80111733 missense probably damaging 1.00
R7834:Syngr1 UTSW 15 80111617 missense probably damaging 1.00
R7917:Syngr1 UTSW 15 80111617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATTTTGCAAAGAGGTCACC -3'
(R):5'- TGTAAAGCAGCGACAGCCTG -3'

Sequencing Primer
(F):5'- AAAGAGGTCACCCCGCTG -3'
(R):5'- ACAGCCTGGAGGTCTCG -3'
Posted On2016-07-06