Incidental Mutation 'R5177:Oprk1'
ID399529
Institutional Source Beutler Lab
Gene Symbol Oprk1
Ensembl Gene ENSMUSG00000025905
Gene Nameopioid receptor, kappa 1
SynonymsR21, KOR-1, Oprk2
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location5588466-5606131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5602674 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 345 (C345G)
Ref Sequence ENSEMBL: ENSMUSP00000125105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027038] [ENSMUST00000160339] [ENSMUST00000160777]
Predicted Effect probably damaging
Transcript: ENSMUST00000027038
AA Change: C345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027038
Gene: ENSMUSG00000025905
AA Change: C345G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159083
Predicted Effect probably damaging
Transcript: ENSMUST00000160339
AA Change: C345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124030
Gene: ENSMUSG00000025905
AA Change: C345G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 284 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-60 PFAM
Pfam:7TM_GPCR_Srv 78 345 5.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160777
AA Change: C345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125105
Gene: ENSMUSG00000025905
AA Change: C345G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Meta Mutation Damage Score 0.8634 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired response to morphine and an opioid agonist, abnormal pain threshold, and increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Oprk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Oprk1 APN 1 5598905 missense probably damaging 0.99
IGL02049:Oprk1 APN 1 5598844 missense probably damaging 1.00
IGL02076:Oprk1 APN 1 5602289 missense probably damaging 1.00
IGL02265:Oprk1 APN 1 5602648 missense probably damaging 1.00
IGL02294:Oprk1 APN 1 5602387 missense probably damaging 1.00
IGL02584:Oprk1 APN 1 5598604 missense probably damaging 1.00
IGL03164:Oprk1 APN 1 5598864 missense probably damaging 1.00
R0295:Oprk1 UTSW 1 5598850 missense possibly damaging 0.78
R1209:Oprk1 UTSW 1 5602261 missense probably benign 0.00
R1420:Oprk1 UTSW 1 5602321 missense probably damaging 1.00
R2994:Oprk1 UTSW 1 5602732 missense probably benign 0.00
R3876:Oprk1 UTSW 1 5602661 nonsense probably null
R4026:Oprk1 UTSW 1 5598685 missense probably benign 0.04
R4096:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4097:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4475:Oprk1 UTSW 1 5602601 nonsense probably null
R5223:Oprk1 UTSW 1 5589296 missense probably benign 0.30
R6397:Oprk1 UTSW 1 5598748 missense probably damaging 1.00
R6647:Oprk1 UTSW 1 5602284 missense probably damaging 1.00
R7169:Oprk1 UTSW 1 5589081 missense probably benign
R7170:Oprk1 UTSW 1 5602396 missense probably damaging 1.00
R8186:Oprk1 UTSW 1 5602317 missense probably benign 0.16
Z1176:Oprk1 UTSW 1 5602702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTGCAGTCTTCATCATCTGTTG -3'
(R):5'- TCCACTTCAGACTGCAGTTG -3'

Sequencing Primer
(F):5'- GTTGGACCCCCATTCACATC -3'
(R):5'- CACTTCAGACTGCAGTTGTAATCTGG -3'
Posted On2016-07-06