Incidental Mutation 'R5255:Abcf1'
ID399538
Institutional Source Beutler Lab
Gene Symbol Abcf1
Ensembl Gene ENSMUSG00000038762
Gene NameATP-binding cassette, sub-family F (GCN20), member 1
SynonymsGCN20, D17Wsu166e, Abc50
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35956819-35969761 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 35959737 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043757] [ENSMUST00000172661] [ENSMUST00000174128]
Predicted Effect probably null
Transcript: ENSMUST00000043757
SMART Domains Protein: ENSMUSP00000036881
Gene: ENSMUSG00000038762

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
coiled coil region 46 79 N/A INTRINSIC
low complexity region 173 208 N/A INTRINSIC
low complexity region 218 234 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
AAA 320 524 9e-10 SMART
low complexity region 529 554 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
AAA 642 807 1.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104738
Predicted Effect probably benign
Transcript: ENSMUST00000172661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173125
Predicted Effect probably benign
Transcript: ENSMUST00000174128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174834
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Abcf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Abcf1 APN 17 35964010 missense probably damaging 1.00
IGL02008:Abcf1 APN 17 35962062 missense probably benign
IGL02209:Abcf1 APN 17 35964009 missense probably damaging 0.99
IGL02218:Abcf1 APN 17 35958338 missense probably benign 0.00
IGL02455:Abcf1 APN 17 35960129 missense probably damaging 1.00
IGL03238:Abcf1 APN 17 35963323 missense probably damaging 0.99
bamboo UTSW 17 35958062 splice site probably benign
IGL02837:Abcf1 UTSW 17 35957581 missense probably benign
R0007:Abcf1 UTSW 17 35959670 missense probably damaging 0.99
R0078:Abcf1 UTSW 17 35958062 splice site probably benign
R0617:Abcf1 UTSW 17 35961187 missense probably benign 0.00
R0655:Abcf1 UTSW 17 35957845 missense probably benign 0.20
R1421:Abcf1 UTSW 17 35960909 missense probably damaging 1.00
R1879:Abcf1 UTSW 17 35961812 missense probably benign 0.13
R3433:Abcf1 UTSW 17 35958217 missense probably benign 0.36
R3915:Abcf1 UTSW 17 35959510 missense possibly damaging 0.46
R4056:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4057:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4114:Abcf1 UTSW 17 35959254 missense probably benign 0.25
R4709:Abcf1 UTSW 17 35960177 missense probably damaging 1.00
R4722:Abcf1 UTSW 17 35958041 intron probably benign
R4932:Abcf1 UTSW 17 35959450 missense possibly damaging 0.62
R5129:Abcf1 UTSW 17 35960795 unclassified probably benign
R5517:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5518:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5660:Abcf1 UTSW 17 35963647 missense possibly damaging 0.87
R5836:Abcf1 UTSW 17 35962026 missense possibly damaging 0.77
R6193:Abcf1 UTSW 17 35963572 missense possibly damaging 0.77
R6247:Abcf1 UTSW 17 35961064 missense probably damaging 1.00
R6257:Abcf1 UTSW 17 35961182 missense probably benign 0.10
R6876:Abcf1 UTSW 17 35959244 missense probably benign 0.45
R7095:Abcf1 UTSW 17 35957511 missense possibly damaging 0.81
R7134:Abcf1 UTSW 17 35959252 missense possibly damaging 0.90
R7475:Abcf1 UTSW 17 35963567 critical splice donor site probably null
R7843:Abcf1 UTSW 17 35959243 missense possibly damaging 0.89
R7867:Abcf1 UTSW 17 35961998 missense probably damaging 0.99
R7926:Abcf1 UTSW 17 35959243 missense possibly damaging 0.89
R7950:Abcf1 UTSW 17 35961998 missense probably damaging 0.99
RF037:Abcf1 UTSW 17 35963188 unclassified probably benign
RF038:Abcf1 UTSW 17 35963201 unclassified probably benign
RF041:Abcf1 UTSW 17 35963201 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGTTTTCGAGTCAGGAC -3'
(R):5'- GACGTTGCTGATTGTCTCCC -3'

Sequencing Primer
(F):5'- TTCGAGTCAGGACTTCCTTTG -3'
(R):5'- GGATGACGTTTGCACTGATATCATCC -3'
Posted On2016-07-06