Incidental Mutation 'R5177:Rc3h1'
ID399539
Institutional Source Beutler Lab
Gene Symbol Rc3h1
Ensembl Gene ENSMUSG00000040423
Gene NameRING CCCH (C3H) domains 1
Synonymsroquin, 5730557L09Rik
MMRRC Submission 042757-MU
Accession Numbers

Genbank: NM_001024952; MGI: 2685397

Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160906418-160974978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 160951652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 552 (V552L)
Ref Sequence ENSEMBL: ENSMUSP00000037178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035911] [ENSMUST00000161609]
Predicted Effect probably damaging
Transcript: ENSMUST00000035911
AA Change: V552L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037178
Gene: ENSMUSG00000040423
AA Change: V552L

DomainStartEndE-ValueType
RING 14 53 5.9e-8 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 1.4e-4 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161609
AA Change: V552L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124871
Gene: ENSMUSG00000040423
AA Change: V552L

DomainStartEndE-ValueType
RING 14 53 1.25e-5 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 5.3e-7 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 1003 1011 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161708
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing RING-type and C3H1-type zinc finger motifs. The encoded protein recognizes and binds to a constitutive decay element (CDE) in the 3' UTR of mRNAs, leading to mRNA deadenylation and degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: A single recessive mutation on this gene resulted in severe autoimmune disease with phenotype resembling human systemic lupus erythematosus. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Rc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
sanroque APN 1 160940830 synonymous probably benign
IGL00417:Rc3h1 APN 1 160955981 critical splice donor site probably null
IGL02302:Rc3h1 APN 1 160938105 splice site probably benign
IGL03053:Rc3h1 APN 1 160955817 missense probably benign
IGL03275:Rc3h1 APN 1 160959555 critical splice donor site probably null
curlyfry UTSW 1 160959399 critical splice acceptor site probably null
PIT4651001:Rc3h1 UTSW 1 160963540 missense probably benign 0.04
R0528:Rc3h1 UTSW 1 160967658 missense probably damaging 1.00
R0609:Rc3h1 UTSW 1 160930135 missense probably damaging 1.00
R1620:Rc3h1 UTSW 1 160954973 missense probably benign 0.02
R1661:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R1665:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R2027:Rc3h1 UTSW 1 160954937 missense probably benign 0.03
R2145:Rc3h1 UTSW 1 160930257 missense probably damaging 1.00
R2207:Rc3h1 UTSW 1 160940025 missense probably damaging 0.97
R2227:Rc3h1 UTSW 1 160963542 missense probably benign 0.07
R2348:Rc3h1 UTSW 1 160950860 missense probably damaging 1.00
R2925:Rc3h1 UTSW 1 160954976 missense probably damaging 1.00
R3977:Rc3h1 UTSW 1 160959399 critical splice acceptor site probably null
R5071:Rc3h1 UTSW 1 160959477 missense possibly damaging 0.76
R5410:Rc3h1 UTSW 1 160964963 missense possibly damaging 0.47
R5421:Rc3h1 UTSW 1 160951830 critical splice donor site probably null
R5699:Rc3h1 UTSW 1 160930253 missense probably damaging 1.00
R5873:Rc3h1 UTSW 1 160959501 missense probably damaging 0.99
R7672:Rc3h1 UTSW 1 160950884 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGCCCAGAAAATAAAATGTTTGC -3'
(R):5'- AGGTGCTGTCTCAAAAGCTG -3'

Sequencing Primer
(F):5'- CCCAGAAAATAAAATGTTTGCCTTTG -3'
(R):5'- TCTCAAAAGCTGGGGCACTTC -3'
Posted On2016-07-06